GenePrediction:GLEAN_7400 Details

Name: GLEAN_7400
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2330773..2329372 (- strand)
Length: 1402
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2330773..2330643 (- strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_140:2330583..2329949 (- strand)
Length: 635
Type: CDS
Source: GLEAN
Position: GCSC_140:2329877..2329372 (- strand)
Length: 506
>GLEAN_7400 class=GenePrediction position=GCSC_140:2330773..2329372 (- strand)
ATGGAGACAGCAGCCCGATTCGACGGTCTTGGCCTCTCCATCACCGGCATTGGTCGCCAATACCCGCCTTTCGCGCTCGG
CCCAGACTCGCTCGAGGCTGTGAGCAAGCGTTTCTACCCCAAGTCGCCAGCGTACGTCTGCGAATGGACGTGACGATGCA
CCGGCCTGGTGGTAGCTGACTCTCGCACAGGATGGACAAGGTGCTCTCGATCAACAGATATACCGGCATAGACGCGCGCT
CGTCCATCGGCCAGCCCGACCATCCGCTCGTCAACCAGGAAGCGGCACCGTCCATAGCCGAGCTGAACAAGGCCTTTTTT
GACGACGGTGTGCCGCTTGCTGTCAGCGCAGCACAAAAGGCCATCACGGAGGCACACATCGACCTGACCCAGATCACCCA
CGTGGTCTCGACCACGTGCACCAACAGTGCCAACCCCGGCTACGACCACTTTGTCGTCAAGGGCCTAGGCATCACCCATC
AGGTCGAAAAGGTGCTCCTGCACGGCGTCGGATGCAGCGGCGGTCTTGCTGCACTGCGCACTGCCGCCAACCTGGCTCTC
GGTCATGCCATGCGCCGCAAGCCGGCTCGCATCCTTGTCGTTGCCCTGGAGCTTAGCACCATCATGGTGCGGAGCGAGCT
CGACAGCATCCACGCGTCCCAAGAAACTAGGATCGGCGTCGCCCTCTTCTCCGACTGTGCGAGCGCGCTGGTGCTGAGCA
ATGGCATCGGCGAGTCGGCTGAGCCTGTTTACGACCTTCTCGGCTGGGATCATCGTGTGATCCCGGATTCTGAAAAGGAC
CTGGGATTCAATGTCGATCCACTCGGTGCGATGCTCCAGTCCTTCTTTCTTCCTTGCTTTTTTAGACCGGTGAAAAATCT
AACACGCCTTCAACAGGCTGGAAGGTCGTACTGTCACCACGAGTACCGCAGCTGACGGCTGCCCAGCTGTCTCCAGCGTT
TGCCGATCTCATCGCGTCTGTGCCAGAGCTACCGTCAGCGTATCAGAAGCCGGATGATTTTGACTGGGCCATGCATCCCG
GCGGTGCCACCATCCTGACCGGTGCAGAACGCGCCATGGACATCACGCCAGAACACATGCGGGCAAGCTACGATACGTAC
ATCAACCACGGCAACTCCAGCTCGGCCACCATATTCAGCGTATTGGACCGTCTGCGAGACAAAGACATGGATACCATCGC
GCCCGGTGGCACTCCCAAGGAATACATCGTTGGCTGTGCCTTTGGGCCTGGAATCACGGTGGAAATGTGCGTGTTGAAGC
GCCATATGGGACGTTCGGGATTGGACACGCCACCGACGTCTGAAAGCGAGGTCGGCCATAGCGAAGCGGATGCGGGGGAT
CTATTTATAAGCTCTGCCATCGCCGGCGTCGAGCTGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62