GenePrediction:GLEAN_7402 Details

Name: GLEAN_7402
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2305730..2305217 (- strand)
Length: 514
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2305730..2305683 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:2305623..2305527 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:2305403..2305309 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_140:2305237..2305217 (- strand)
Length: 21
>GLEAN_7402 class=GenePrediction position=GCSC_140:2305730..2305217 (- strand)
ATGCCAGTCCCCTTCGAAGCTCTGATCCCTTATGCGATCATCACTGTGGTAAGAACGCGCCAGAGTGGCCGGGGCCGGAA
CATTGGAAGTATACTGAGAAAATATAGATGTTCGGAGTGTCCGGCGCTGGTTTGTCCAAGCTACGAAACATGCAGAACAG
CGGATTGCGGCCGCGGCGGTCTGTGGATCAATGGGACAACGTAGGTCACTCATAAAAGCTTTCTTGTGGGAACCAATTTT
TGCTAACAAGCACTGCAGCAAAGTATGAGCCAAGACACTCAATTCGAGCCTTTCACTTGGAGATCGATGTGCTGACCTTT
ACAATAGTGATGGACCGTGATCGGAGACTGACTGGACTCTTACGCGGACAAACGGCCAACGCGACAGCACCAGCCGGCTT
TGAAGTGAACAATGCCTGGAAGGTACGCTTATGTCCACCAGTTCTATAGTCTCCTGGAGAGTATCGCAGCTAATAACTTG
TTTGCAACGACAGGTAGAGAAGCGCTTCTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62