GenePrediction:GLEAN_7403 Details

Name: GLEAN_7403
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2303473..2302230 (- strand)
Length: 1244
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2303473..2303471 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_140:2303153..2303076 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_140:2303008..2302499 (- strand)
Length: 510
Type: CDS
Source: GLEAN
Position: GCSC_140:2302430..2302230 (- strand)
Length: 201
>GLEAN_7403 class=GenePrediction position=GCSC_140:2303473..2302230 (- strand)
ATGGTAAGCTAATTTGATATAAACGAACTCGACAGCTTCAATCGTGATGCTTCCTAGTATGCGCTTCATGCGCAGAACGG
CCAGGGTGTGATTCAGTTCACATCTTGCGCACACATTCCACCTGGTCGTCCTCTTCAGAGTCTCCAACTCCGTTGAAAGA
GCGGAGTGGGAGTGATGAAATGGACGCCGGTGATTCCTTGGCTGGAGTCCATACTACGGCGTCGTTGCGCAGAAATGCTG
TCGTCGTCGTTGTATGGTTCTCTTTAGAGTTAAAACAGAAGACGTACAGTATGCTGATGTCTTCTTTTTCTCAATGACAG
CCTCCGAAAGCTTCCGGTAAGAAGGTGGCCCCGGCCCCGTTCCCTCAGGGACGTGCGGGTGCGAAGAAGGTTGCCAAGGT
CAGTAGCACTCCCCTCCCCTGCGATTTGTCCTGTTACAAGGTTTGTGCTGACACCGACATGACAGAACCCGTTGATCGAG
AAGCGCCCTCTCAACTTCGGCATTGGCCAGGACATCCAACCCCGCCGCAATGTGTCGCGTATGGTGAAGTGGCCCGAGTA
CATTCGCCTGCAGCGCCAGAAGAAGATCCTGGGTCTGCGCCTGAAGGTGCCGCCCGCAATTGCGCAGTTCCAGCACGTGC
TTGACCGCAACACGGCTGCGCAGGCTTTCAAGCTCCTGAACAAGTACCGCCCGGAGACCAAGGCGGAGAAGAAGGAGCGT
CTCCTCAAGGAGGCTACGGCCATCAAGGAGGGCAAGAAGAAGGAGGACGTCAGCAAGAAGCCGTACACGGTCAAGTACGG
TCTGAACCACGTTGTCGGCCTGGTCGAGAACAAGAAGGCTTCGCTGGTCCTGATCCCCAACGACGTCGACCCGATTGAGC
TGGTTGTCTTCCTGCCGGCTTTGTGCCGCAAGATGGGCGTCCCGTACGCCATTGTGAAGGGCAAGGCCCGGCTCGGCACC
GTCGTGCACAAGAAGGTGAGGATTACTCGGAGTCTACGTTGCTTTACACTGCCTAGCCGTTTGCATGCTGACTGTGGAAC
CAGACTGCTGCTGTTCTTGCGTTCACCGAGGTGCGCTCCGAGGACAAGACGGAGCTGTCCAAGCTCGTCTCGGCCGTCAA
GGACGGCTACTTGGAGAAGGGCGAGGATGCCCGCAAGCGGTGGGGTGGTGGCATCATGGGCGAGAAGGCCAACAAGCTCA
TCGAGAAGAAGCGGAAGGCCATTGAGACGGCCATCAAGGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62