GenePrediction:GLEAN_7404 Details

Name: GLEAN_7404
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2299695..2298724 (- strand)
Length: 972
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2299695..2299683 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_140:2299590..2299480 (- strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_140:2299292..2298724 (- strand)
Length: 569
>GLEAN_7404 class=GenePrediction position=GCSC_140:2299695..2298724 (- strand)
ATGACCGAAATCCGTAAGTCTAGCTCTTATCCCGTCCTCTTGTGGCTGTTTCTCTCAGGCTGCTATCTTCCCGTTCTGCA
TTGCTCACCGACTTTTTCTGCTCAGAAACGACCTTTCAGTATGCCATGAGCTCCAACAATGCTTGGGCTGGCTATAAGGC
ACACCAGAACCCAAGCTTCTTTCAGCAGTTGGCCACTAGCCAGACACCCCAGATCCGTAAGTCGTCATAGCCTGCTGATA
ATCCTTCCCCCCTGGTCAGCTCCCTTTGCCTCAAAAGCTTCCCCCCCCCCCGGCCCCACCCTCTGTCTCTTCACCTTAAC
CCCCTTTTCTGGGGCTCTCTTCGGATGTTTCGGTAACAGCCTGCTGTTTCTCTCATGTTTCTGACACCCCCACCCAACTA
CAGTCTGGATTGGCTGCTCAGACTCCCGCTGTCCCGAGACAACGATCCTCGGCCTGCAGCCGGGTGATGTGTTTGTGCAC
CGCAACATTGGCAACATTGTGTCGGGCAGCGACCTCAACACCTCGGCTGTGATTGACTATGCGGTCGCCCACCTCAGGGT
CAAGCACATCATCCTGTGCGGCCACACTGGCTGTGGCGGGGCGACAGCAGCCCTGCACGACACGCCAGTCGGCGGCGTGC
TCGACGTCTGGTTGACGCCGCTGCGGGCGATCCGACGAGAGCATGCCGACGAGCTGGCGGCCATCACCGACGTCAAGGCG
CGGGCCGTCCGCATAGCCGAACTCAACGTCGAGTCTGGGGCCCGGGCGCTGATGGCCAACCTGACGGTGCAGGAGGCCGT
GCAGGAGCGCGGTCTTGAGGTGCACGGCGTCATCTTCGAGCTGGACAGCGGCCGGATGCACGATCTCGGCGTGGGCACCG
GCAGGTCAACAGCCCATGCCAAGAGCATCGTCCGCGGCAAGCACGCCGCTCTCGTCTTTGCGGGCGACAACGCATCCATG
GCCGTCCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62