GenePrediction:GLEAN_7405 Details

Name: GLEAN_7405
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2297649..2296146 (- strand)
Length: 1504
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2297649..2296649 (- strand)
Length: 1001
Type: CDS
Source: GLEAN
Position: GCSC_140:2296596..2296146 (- strand)
Length: 451
>GLEAN_7405 class=GenePrediction position=GCSC_140:2297649..2296146 (- strand)
ATGTCGCTGACCATCCTGACCGACGAGCAGATTGCGGGGCTGCTGGAGGACCTGACGCTGGAAGAGGCCGAGGGCTTCCG
CACTGCGCTCAAGACGGCCCTGCACGAGTACTCGACCGGGACGCAGACGGCCGGCCGAGGAGACGATGTGCAGCAGCCGC
CGCGGACGACGATCTCGCCGGGAGGCGGCAGCACGCGGCCGTCGACTGTGTTTGTGCCGTCATGGAGCCACGACGGCGTG
GGAATGAAGGTATTGACGCTGGCGCCACCGGGTGATGGCGATGGCGATGTTGATGGTGATGGCGAGCCGGCCATGCGGCC
GACCGGGGCCCTCTCGCTCTTCTCGCCGGCCGGCCGGCTGCTCGGGGTCCTGCATGCGAGCACGCTGACGGCATTTCGCA
CGGCGCTGGCATCTTCATGTCTGTTGCTGCGGCGTGACACTGTGCAGAATGTGCTCGTTTTCGGCAGCGGCATGCAGGCG
TACTGGCACGTCCGGCTGGCACTGCTGTTTCGCGGTTCGACCATTCGCCATGTCAACATCATCTGCCGGCGACTGTCGCA
GTCGAGCCAGCTGATGCTCAAGCGCTTCTACAGCACGCCGGCCTACCGAAAGGAGCGCGAGGGCTGGGCCGAAACCCAGT
TCAGCGTCCTCACGCCCGCCTACAACGAGTACAGCCGGCTGCTGGTCAAGAACCTGCGCAGCGCCGACGTCATCTTCTGC
TGCACGCCCTCGACCGAGCCGCTCTTTGATGCGTCCGTCCTGACGAGCCACGAGGGCCGCCGCAAGGGCCGTCTGATCGT
CGCTGTTGGCTCGTTTATGCGCAGCATGCACGAGCTGCCGTCCGAGCTGCTGCGCCAGGCTACCCGCACCGAACGCCCGC
ACCACCATTACCACAGGCATGCCGTTGAGGGCGGCGTTGTCGTGGTCGACACGCTTGACGGCGCCCTGAAGGAGGCTGGC
GAGATCATCGATGCTGGCCTGACGCCGCGACAGGTGGTGGAGTATGTTTTTTTCCTCCTACTTCTTCCCTATATACCACG
TACTGATAGACAGGCTTGGCGAGCTGGTCATGCTGTCACGCGTCAACCTCAAGGAAGAAGAGTACGGCTCATCGTCCGCG
GCCGCAAGCACGAGCACGCTGAGCGTGCCGTCGCTCGAGTTTGAGAGGCTGGATTTGCAGTCGATGCAGATTTCCGCGTC
CTCGTCGGCCATGTCGACCGTGTTCGGACAGGACAGCAGCAAATCGTCCGGGCGAGCAGCGTCGCCCTCGCCCAAGAGCG
AGGGCCGCAGTAGCCGCAGGTCGCTGCAGCTTCACCGCCGGAGCTCCAGCCAGGCGTCGGTCGACACCCGGAAACAAAAG
GATGACCACCTGGCACGGTGGATGCAGCGCGGAAACGTGGTGTACAAGAGTGTGGGGCTGGGTCTGATGGATCTCAGCGT
CGGCCTGCACCTGATCGACTTTGCGCGTTCAAAGGGCGTTGGCAGTCACATTGGCGGATTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62