GenePrediction:GLEAN_7406 Details

Name: GLEAN_7406
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2292681..2291240 (- strand)
Length: 1442
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2292681..2292675 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_140:2292617..2292523 (- strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_140:2292460..2292099 (- strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_140:2292038..2291240 (- strand)
Length: 799
>GLEAN_7406 class=GenePrediction position=GCSC_140:2292681..2291240 (- strand)
ATGGGTGGTACGTTTCTCAGCCTCCAGTGACCGCCATCTTGATAGCTAACATGTCCTTCTGCAGCACTCGACCGTTTGAA
CCAAATCTCGAGCCAGCTCTCGGGCGGCGCCAAGGCCGCCGATGGCAAGGCAAAGCTGCTAGAGAAGAGCCCCGACGATG
TAGGTCCCTCAAAGAAGGGAATAAAGGAGACGAGAAGGCATGCTAACGCGGACGTGTCCAGGTGGTTGTGACGGCCTGCC
TGCGCACACCATTCACACGAGGCGGCAAGGGCGGCTTCAAGGACACACAGGCGTCGGACCTGTTGGCAGGCGCGTTCAAG
TCGCTGCTGGAACGGTCCAAGATCGACCCAGCCTTGGTGGAGGACATTGCAGTGGGCACGGTACTGGCGCCGGGTGGCGG
TGCGACCGAGATGCGGGCAGCCGCGCTGGTGGCCGGCTTCCCGACGACGACGGCGGTGCGGACGCTGAACCGGCAGTGCT
CGTCGGGGCTGCAGGCATGTGTGGACGTGGCCAACCAGATCCGGACCGGGATGATTGACGTGGGCATCGGAGCGGGTGTC
GAGAGCATGAGCACACAATACGGGTGAGTTTCTGTTGCTTCCGCCCATTCCTTCGTACTCCGACCTCTCCGCTAACTTCT
CAGCCCCGGTGCTGTGAGCGAGTTCTCGGAGCTGCTCGAGAGCGTGCCCGAAGCAGCCAACTGCAAGGTGTCGATGGGCC
AGCTGTCGGAGGACATGGCCAAGGCCCGGAACATCTCGCGGGCGTCGCAGGATGCGTTTGCAGCGGCGTCGTACCAGAAG
GCCGCCAAGGCGCAGGCGGCAGGTCTCTTCAGCGACGAGCTGGCGCCGCAGACGGTGCGTTTCGAGGACCCCAAGACGGG
CGAGACGCGGACGATCACGGTCGATCGGGACGACGGGGTGCGGCCGGGTGTCACGGCCGAGTCGCTGGGCAAGGTTCGGG
CATCGTTTGCCAAGGATGGGAGCATTCACGCTGGCAACGCATCGCAGATCTCAGACGGTGCGGCGGCCGTGCTGCTGATG
CGCCGCTCCGTGGCCGAGCGACTCGGTCAGCCGGTACTCGGCAAATTTGTCGCCGCCTCTGTCGTCGGCGTGCCGCCACT
TCTGATGGGTATCGGTCCTTTCAAGGCCATCCCGCGCGTGCTCGAGCGCACCGGTCTCTCGGTCGCCGACGTCGACGTCT
TTGAGATCAACGAGGCCTTTGCCAGCCAGTGCCTCTGGTGCGCCGACCAGATCGGCATCCCCGCCGAAAAGATCAACCCG
CTCGGCGGCGCCATCGCCTTTGGTCACCCGCTCGGCTGCACTGGCGCCCGCCAGGTGTCCACCTTGCTGTACCAGCTGCG
CCGCTCCGGCCAGCAGATCGGTGTCACCAGCATGTGCATCGGCACTGGCATGGGCATGGCGGCCGTCTGGGTTGCTGAGT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62