GenePrediction:GLEAN_7407 Details

Name: GLEAN_7407
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2283874..2282650 (- strand)
Length: 1225
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2283874..2283832 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_140:2283760..2283728 (- strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_140:2283631..2282853 (- strand)
Length: 779
Type: CDS
Source: GLEAN
Position: GCSC_140:2282790..2282650 (- strand)
Length: 141
>GLEAN_7407 class=GenePrediction position=GCSC_140:2283874..2282650 (- strand)
ATGCCCTTCAATACGGAGCTCACGCGGCGGCTGGGGATCAGAGGTAATCTCCCGCAACACGTGCAGTCGCCCCTGAGCAA
GCGTGGTCCGGGGAGCTAACAGCACTGCGAACAGTCCCGGTGGTGCAAGGTGGCATGATGCATGTGGGTATGTGACTTTT
CTTCCTGCTTTTTGCCTCCTGCTCAGCATGGGCCGCGGATCGTACGACCGCAGCTGACAATTTCTGCTGCGCCCCTTCCC
CAGGATATGCGGAGCTGGCATCTGCCGTGTCCAACGCCGGAGGCCTAGGCCTGATCACGGCACTGATATTCCCGACGCCG
GAGGAGCTGCGCGCGGAGATCCGACGATGCCGCAAGCTGACGGGCCGGCCGTTTGGCGTCAACATCACGTTGCTGCCGTC
GCTGGTGCCGCCCGACTACGAGGCGTACGCGCAGGCGGTCATCGACGAGGGCGTGCGCGTGGTCGAGACGGCTGGCAACA
GCCCCGGGCCGGTGATCGCGAAGCTGAAAAAGGCCGGCATCACGGTGCTGCACAAGTGCACGACCATCCGCCATGCCGTC
AGTGCTGTCAAGCTGGGCGTCGACTTTTTGTCCATTGACGGCTTCGAGTGCGCCGGCCACGTCGGCGAGTCCGACATCAC
CAACTTCATTCTGCTGAGCCGCGCGCGTCAGACGCTGCAGGTGCCCTTTATCGCGTCCGGCGGCTTTGCCGACGGCCAGG
GCCTCGCGGCCGCGCTCTGCCTCGGCGCCTGCGGCATCAACATGGGCACGCGCTTCATGTGCACGGTCGAGGCGCCCATC
CACCAGAACATCAAGGACGAGATCGTGCGTGCCCAAGAGACCGATACCGCCCTGGTCCTGCGGCGCTGGCGCAACACCAC
TCGCCTGTATCGCAACAAGGTCACTGAGGAGGCCCTCCAGGTCGAGCATGGCAGCACTACGGGCGAGTTTGCCGAGATCG
CCCCCTTTGTCAGCGGCAAGCGAGGTCGCCAGGTCTTTATCAACGGCGACCCCAACTACGGCGTGCGTCCGCCTTTTCTC
CCAGCTTGTTGTTTTTCGTTTCCTAGCAGCTAACTCCCGCACAGGTCTGGACGGCAGGCCAGGTCATCGGCCTGATTCAC
GACATTCCCACATGCGACGCGCTGGTATCGCGCATCGAGAAAGAGGCCGAGACGACGCTGAAGGAGAAGCTGGACCTCCT
CGCGCCTCCGGAAAGCAAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62