GenePrediction:GLEAN_7408 Details

Name: GLEAN_7408
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2281026..2278703 (- strand)
Length: 2324
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2281026..2279886 (- strand)
Length: 1141
Type: CDS
Source: GLEAN
Position: GCSC_140:2279829..2278935 (- strand)
Length: 895
Type: CDS
Source: GLEAN
Position: GCSC_140:2278778..2278703 (- strand)
Length: 76
>GLEAN_7408 class=GenePrediction position=GCSC_140:2281026..2278703 (- strand)
ATGTCTCACAAGCCGATGTCGATTGAGGCGGTGATGGATGAGGAGCGGAGGGAAGTTCTTGCGCTGCTTGGCAAACGCAG
CGACCAGAACAGGCGGTCGTCGAGCGTGGCCAGTGCCCAGAGATCTGTTACCAGCCGGTCTGGCTCGCCCTTCACCCCTG
GCGTGCGGTCACCAATGCGAAGCATGCTCGACTTTGGCGATGACAGCCCGGAGACAACGCCGCCGACAACCAGCAAAGCC
GCCAACAGAGGTTCTCCGCGCGTCCAGACCAGGACCATCCGCAGCATGTTGGACGTCGACTCTAGCCCGGCTCTGTCTCC
TATCAAGCAGGTGTTTAGTGCCCAGAACTCGCCGACGGAGGCCAAACACCGGATGCAACTGGGCGGCAGCTTGTCAAATC
ATCCGCGCAGCATGTCTGACGTATCTAGCAAGCCCGCCAACTTCGGGCCGCGCTCGTCGCATGCCAGGGGCGTTAACCCC
TCGGCTGACTACCAATTTTCCGATATCATTACGAGCCGAGATACCCCGGCCTTCATTCCCAGACGAGCGATGCAGAATGT
GGGCGCTAATTCGGCAACCGCTGCCGCAAAGCGCAATAGCTCCGTGGCAGAGATTATCCGGAATGCAGACCTCAGCGGCC
TTATGCTCCCGGGTAGCCAGAACCCCCTGCACGGTCGTCCTCAACCGTCCACGCGTGGGTCTACAGCAAAGTCGAAGTCG
CCTCACGGTCGCCTTAACCCCCGATCCAAGTCGCCGGGCGCTGCGCTGTCCGCCAGGACGCTCAGCCCTGCTGGGCGTGC
CCTACTTGCCGAAACTCAGCTCGATATGCAAAACGCGTACCGTCGCCTGTCTGATGCCAACCTCATCCGGTCGGGTGGCA
GTTTGAGCGAGCTTCCCAGACGCAAGCACTCGGACGGCAACGACATTGGCAATGGCCGTCTGACCAAGGACTATCTGAGC
CCCGATGGTGATGAGCTTGCCGACACCAGCGACGAGGAAGAGGCTTACTCGTCGGAGGATGATGAAGGCCGTGGCCGGAA
GACGGCCAGAAGTTTTCCAGATGAGCTGCCATGCTCAGCCAGCGCTGCTGGCAAAGACGGGCGGCAGCCGCTGAGCCTGC
TGGCTGCCGCGGAAGAAGAGCGTACGTTCCTCGTTCTTTCACAGCCGCATCTGCCCCCTTACTGACGTTGGAATCAGGTA
TCCAAGTGTCACAGAATTACCAGTACCGGTCGCTGTTCGATGAGCCAGAAATAACGGTGACAAATCCTTCAGGCGAAAAG
GTGAAGACGGCGAAGGCCGGCGTTCACCCGGCCAATAGTTTCGATGTCCCTTCAAGATCCGCATCTAGAACGCCGTGGGA
TTCGGACGACGAGGCCGAATATACCGACATCAAGAGCGCACAGAAGCTTGCCTTCACGATGACTCCCATCATGTCGACAC
CAGATGTGCCGCGCTCTGTGCGCATTATCTACCGGGGCGATTTTGTGAAAATACAGAAGGAGGTCACCGAGGAGGAGCAT
CGGCGCCTGCGGAAATACCTAGTTGCCACCGACCTCAGCGAAGAATCCACACACGCGCTGGAGTGGGCTGTAGGCACGGT
CGTTAGGGACGGCGACACGCTCGTGGCTATCTATTGCGTCGATGAGGAGACTGGCATTCCGCCCGCCGATGGCCCGGGAG
AGCCAAAAAGCGCGCGCGAGCAAGCCGCATCATCTTCGACCCCGTCAGTCCCGAGCAAGCTCTCAGGGATGACCTCGCTA
TCTACCCTGGCAACTATGGCAGGATCGAGCCCCGGGCTGAGCGGCGGGACACCCATGTCTTCAAGGCCATCGCTTCTGAC
AAAGAACAGTGACTCGTCCACAACGATATCGTCTCCGGTAGAGCGGACAAAGGCCGAGGAGGAGCGGGAACGGGCAGTGC
AGGATATCACAAACCGGATAACCCGATTGTTGCGCAAAACCCGCCTGCAAGTCCGGGTCATCGTCGAGGTTCTGCACTGT
AAGACGCCGCGGCATACTCTGACAGAGGTTATTGATATTTTGAGTCCGACGCTTGTGATTTTGGGCAGCCGGGGCCGAAG
TGCCCTCAAGGGGTAAGCCGGTTTCTCTTTCCTCTTCTTTCCAGCGAGCGGGTTGGTCGCTAACAGCAGCAGTGTAATCC
TTGGCTCATTCTCGAACTACCTTGTAACTAAGAGCTCTGCTCCGGTGATGGTGGCAAGGAAACGACTCAGGAAACAGAGC
CTCTATAGGCGGCCACCAGTGAACCAGGTCAACAACCTCAACAATCCGACGGCGAGGAGCCTTGCCAACGCGAAGATCGA
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62