GenePrediction:GLEAN_7409 Details

Name: GLEAN_7409
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2277198..2274468 (- strand)
Length: 2731
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2277198..2276995 (- strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_140:2276308..2275771 (- strand)
Length: 538
Type: CDS
Source: GLEAN
Position: GCSC_140:2275711..2274468 (- strand)
Length: 1244
>GLEAN_7409 class=GenePrediction position=GCSC_140:2277198..2274468 (- strand)
ATGCAGCCTCTCTTTGCCGTCCACAACAACGTGTCTCTGCTGAGCGTGACTATCGCCCCCAGCACGTTCTTGGCCTCTTT
GACCCTGGTCCTCGTCTTCTTTGCGCTCTTCATTGCGCTTTACATTCCGAGACTCCCGTTTCTTTCGCGCATCTTTCGAT
CTGGTCAGCGTCGCAACAATCCACCGCATCCGCAGGTGTTTGAGGTCAATGAAGAGGACGACCGAGCGCAAGCCTTAATC
CGCAGACAGCGATATCAGGATATCTACTTTGAGGACTGGCGCCATCGCGAATTGCCGCCACTGCCTCCACTGCCTCCACC
GCCGCCATTTCCACTGCTACGGGAACGCGGGGAACCTGGCGCAGACGGGCGCGATTACGTGAGGCGAAAGAGCAGGAGTG
AAAAGGACAGAACCAAGAAGGAGAAGGACAGAGAAAGGGAAGGCGAGAGAGAGAGAGAGACCGAGACCGAGAACGGGAAC
GGGAACGGGGAAACACGAGAGAGAGAGGGTGAAGCTGAAGTCAAGGGACAGAACGTCTGGCTTCAAGTCCATTCAGTCGC
CTTCAAAGAAGAGGAGCGAGAGGCAAGGCCGATTCAGTCAGGAGCCTTCTACGGAGCTCGTTGTGCGTTCCAGACGTACT
AGCCACGGCGTGTATGCAGATTACCGCCAACTCAACGACAACGGCGATAGCGACAGCGACAAGGGAAGCCGGATTGACCA
CGACAACGTCGGCGTCGGCGTCGACCGCAATGCAGACGTTTGGGGCTCCCTTGGGACGTTTGGACGTCTCGCCGCTCGAT
TTCGAGCCGTCCAGCCGGCAGATGACACCCGGTTCAGACCGCTCTCACTTTCATCCTCACCACCAACACCGGAATCACCC
ATCACAACAGCCGGCGCAGATCAGCGACAGCAGGAACTTCGGCTACCTCTCGACTCACTCGGGCTTCCTCGAGACCGACA
CCGAGAGCATGCGCGACTCAGTCTCCGTCGGTGGCTACAGCCCACCGGCGTGGCGTCGCCTCGGAAACGGCGACCGTAGT
TCCGGCTTCTGGCGCAACTGTGATAACATCCTCGGCTCGCCCACGATGACCCCGGCCTGGTCGCCGTCCCTGTTGGCACA
ACAACGACCCGTCAACACGGCCCAGTATCAGCAGTATCAGCCCGATCGGCAATCCCGCGAGTGGAGTCCTGGCTTCTCCA
GCGCCGACGAGGATGTTATCGACCCGGACGACGATGTGTTTGGCAACGACGACGACGACGAAGAAATTCTCGCCCAGGCG
ATGCGCACCCGTCTGCCCCGAAGTATGAGTCCGGAAAAGGAGCTAAGCCCCGAGGCTGAGGACAGAATGTATCTAGACAC
AGCCCACAGGACAGACGACATTGAGAACCAACGTGAGAAGCCTCCAGAGCTGGAGCTGTCAGAGAACTGTCAGTCACCTC
AGTCACCTCAGTCACCTGCTGGAAGTGTGCGACTCTAACAGGCGCAGATATCCGGTTCGCCGTGAGGGCTGAAGTGCAGC
AACGGACGGAGCCGATTGAAGCGGCCATCAACTTTGCGCGGAACAAGTTTCTGCTGGCAACCCGGTCATGGGCCCACGTA
TTCTGCTCGATGATCGTGGCCATGTTCTCCGTGGCGGCCATGCGGTGGCTGTCGCAACCGGCCAGCATGCGCATGGTACC
AGATCTGGTCAAGGTGGCCGGCATCGCGCGAGCGTTTGAGCCGCTCATCTTCTACTCGGAGAACGGTGTGGCCCAGGTGG
GCGACCTGCAGGCCACCGGCATCGCGGTCTGGGACCTGGGCGAGAGCGTGCGGTCCAGCAATCTGACGTCGGCACCCATC
ATTGTGCGGGAGCTGGACGAGCTGAGCGAGACGCTCAAGACGCTGGCTATCGAGCTCACCAAGTTTTTTGCCAATGTCGA
TGGCGATATCGACGGCATCCTCATTGTCATGGACTGGGCCCGACGTGAGCTGTCACAACTGCAAATGCAGGAGCGTTCCC
AGCAGCGAGCGTCGCTGCCGCCGGTTCTGACGAGCGCATACGACAACATCCACAATCTCCTCAGCTCAGCGGGCGTGCTC
GAAAACGCGGCCACGGGCCTGCCGACGCGAATGGGCAGCGTGACGATGGCGCTGTTCGGCATGTCGGGCCCGCAGCGGAC
GCGTGCCACCTTGCGTCGCACCTTTCACGAATTTCTAGCCGTGCTGGAGGAGGCCGTCAGCTCAGAGCTACAGCACAGCC
TTGCGCTGTTTGGGCTCTTTGAGGCCGTCGACCACCAGTTCCTCAACCTGGCCCGCACTGCTGCGCGGGAGGCGTCTGTG
CAGGAAGACCTGCATACAGACCTGCTGACAAGCCTGTGGACGCGTATTCTGGGTCCCAACGCGGCCGAGGTCAAGAAATA
CGAGAAGAACCGCGAACTGCTGCGCGACGTGCGTGCCAAGACGGTGCGGAACAAGGGCATCTTGGTGGAGCACAACCACC
GGCTGCTAGCGCTCAAGGCCAGCCTCGAGAGCCTGCGGCGCAAGCTGGTGTCCCCGCTGGTGCGCTCGGTGAACAGCAGC
ACGCTGACGCTGGAGCAGCAGGTGCGCGGGCTCGAGGATGTCGGCAGCTACCTCGAGGGCGTACGAACGCGGCAAAAGGG
CAAGCTGATGGAGATGCTGTACGGCTCTGGCCGATCGACCGCAGGAAGTCTGCGCCACGAAGATGCTGGACACCTTATCG
AGGAGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62