GenePrediction:GLEAN_740 Details

Name: GLEAN_740
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1803844..1808014 (+ strand)
Length: 4171
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1803844..1803911 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_97:1803980..1804091 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_97:1804169..1808014 (+ strand)
Length: 3846
>GLEAN_740 class=GenePrediction position=GCSC_97:1803844..1808014 (+ strand)
ATGGCCGACCAGGTGTTGATAGCCCATACGGGCCAACGCCTTCAGCTGGACTTTGCACAGCTCACCTCGTATGTTTGGCC
TGTCCTTGTCTTTGCACTGCTGCGCATCATGGCTGCTCTGTCTAACCGTGCGGCAGACTTGATGAATTCAGGGCTTTTGT
CACACGCGAGACGGCCATACCATCCGACTGCATCATCACGCTTACTCCTCAGGGAAAACCTCTCCGACTTGCCGCATTCC
AGACAGAGGTAGGCATGCACGGGCTCCTCTAGAGTACTGCTTTGTCCTTTCCTTTTTAACGACTGCTAATTTGTCTGTGT
TGCAGAAAGAACTCTACGTATACGATGCGCGTATGGCTCAACCCGATGCTGCTGGCGCAGCCGTGGCCAACCTCGAGCTG
CCTTTACCGAAGAAATACACGGCGCCGATTCCGCCCAACGACCTCCGCGACCAACGATCGCTTGCAGCATGGCAGGAGCT
GTTTCACACGCGGCAGAAGTGGGCGTCAGCAGTGGTTGACGACTGTGCAGTCAAGGCCGAAACGGCCCACGAGCGATACT
CGGAGATGGACGCGATGATGCGCTGCTTGGACGCGGCGGTAGCCAACCTGGAGGCGGTAGTCAAAGGCGTGGAGACCAAG
TATACGGACGTCAAGAAGTGGATCGGCAGCGCGCAAGCAGACTACGCCCATCTGGTGGACAAATGGGAGCAGTATCTGGA
TATAGCGCGGAATATTCCCATATCGGCGGCGATGCTGCAGTTCATGACAGGTCAGGACAGAACAGTGGCGCCAAAGGGCA
AGAACTCGCGGCAACAGGCGCAGGTCCGGGCGACGCTTGAGGACCTGGTGGACGTGGAGACTGCACGCAAGGCCGGCAAG
CTGGCGCCGGCGGCACTCCGACGGTTCATGGCCAAGGTTGCTGAGCTAGAGCGAACGGCTCCGCGTCTTCTTCAGGGTTG
CGAGGACGTGCTGCGAGGCTTTGAGCAGACGGTGGACGGGTCAGCGATGTCGCACGAGGGCGAGGCGGCGCAGCTGCTGC
AAGATATCCGGGCGGTGGCGTCGAAGATCGAGACGGACTACCAGACAACGCTGGAGTACACAGACGACTCGGCACGAGAC
ATTCTGCAGGCGTCAAAGATTGCAGCAACACACACGGAGCGGCTTCTGCCAAGTCTGCGGAACCGGGCGGCCGAGATGGA
CGAGATGTTCCGATACGCGATGGAGTCGCGCAACCGGCTGGCAGCAGAGTCGGTGGATTTCATGCGGACAATCACGGAGC
TGACACTGGTCAGCAGCACGGTCAAGAGCCAGATGGGAGCGCTGGGCGGAGAGGAGGACATGGCGCACTTTGACTACCTG
CGGCTGGTGCAGCAGATTCCGTTTGTATACGCGTCGTTTGTCAGCGAGGCGATCAAGCGACGCGAGTGGCTGGACAAGGT
CAGGACGGACTCATCGACGCTGGCCAACGAAATGTCAGTGTTCCGCGACGAGGAGGTGAAGCGGCGGCGGAAGTGGCAGA
AGTCGGTGGGGAGCCTGGAATATGGGCCAACATCGACGCGGATGGGGACGGCAGCAACAGCAGCAGGCGACAACCAGGTG
GTGGGCCTGGAGGTAAACCTGCTGGGCGAGGAGGCAGAGTGGCCAGCGGTGACGCGGCGGGAGCTGGAGGAGTACTTTTC
GGTGCTGCAACGGCAGCAGGCGGAGACAGAGCTGATCGAAGATATTGGCAAGCTGATGGGGGAGCTGCGAGCGCCGACGA
AGCAGCAGTCGAAGCGGATCAAGGCGTTTCGAAACGGCAGCGTGCACGAGGCAGCGTTGGGGCGCAGCGGGCTGATGATC
CGGGGCGACGACGACGTGCTGCGCAGCCTGCAAGACGACAAGGCGCGGGTGGAGGGCAAGCTGCGGACGGCTGAGAGCCG
GGTGCGGCGACTGGAGGACCTGTTGCACCGACAAAGCCAGGCGTCGCGGGCGAGCATGGGCAGCGGGGCGCTGTTCCAGC
AGTCGGGCGAGCAGCGGGCGGAGTCGCGGGGCGGCGAGCACAACCGGCGGACGTCGGCAGAGGGTGGTGGCAGTAGCATG
GCGTCGACAGCAGCAGCAGCAGCAGCGGCGGCGGCGGCGACAGAGCTGCGAGCGGCACAGCAGCGGATGCAGCAGCTCGA
GGGCGAGCTAGCGGCGGAGAGAGAGCGAACGAGCTCGTTGTCGGGCGAACTAGCGGCGGAAAAGCAGCAGACCGACGCGC
TCGAGGGCGATCTGGCGGTCGAGAGAGAGCAAAGGGGATCGCTGGAAGGCGAGCTGGCAGCCAAAAAGGAGCAAATTGAC
TGTTTGGAGCGAGAGCGCACAGCAGCCGAGAGCAAGACGGAGGAGGCCAACTCGACGAAGAAGGACCTGCTGAAGAACCT
GGAGGGTCTCGAGCGGGGCTTTGCGCAGGAGCGGCGGTCGTTGGAGGAGGAGATCCGGCGGCTGCAGGGGCGAATCGAGG
ACGCAGAGGACGAGATGGAGCACGAGAGGGCAGCATTTGAGGAGCAGACGCGGGCGTTGCAGGGTGACGTGGCGCGGCTG
GAGGGCGAGGCAGCAGAGCAGCAAGAGGAGGTCAGGACGCAGCGGGAGAGCAGCGAAGTGTTGGAGGGAGAGCTGCGGGT
GGTGAAGGAGGAGGTGAAAGCAGCAAAAGAGCAGCAAGCAGTACAGGTGCAGCTGCTGCGAAAGCTCCACGAGCGGATGG
ATGGGACGAACTCGGAGGCGGACTCGACGAAGCTGGCAGAGGCAATGCACCACCGTCTAGACGAGATGCTCTCACAGCTG
CAGACAGCGACAGAAGCACAGAAGAAGGCGGAAGCGCGAGCATCGACGCTGGCAGATGAGCTGACGGCGGAGATGAAAGC
ACGACAGTGCCAAGCCGGCAATGTGGACGAGGAGCTCCGAACGACACAGGAAGAGCTGCAGACGGCACAGACGACACAGA
CTCGGCTGAGCAGCCAGCTGGAAGGACGGACTCGACGAGCCAGAGAAGTGTCGCAGCGGCTGGGCACGCAGACGGAGCGA
CTGATACAGCTGCTGGAGCGGCTGGGGTTTATGGTCAGCCGGGAAGAGGGGAAGACGGTGATCCAGCGGGTGCCACGGGC
CGAACGATCAGGGATGCTGGTGGACGGTTCTGGGCCCAGTAAGAGCACAGGGGCGCAGACGGACTGGACGGACGACGACG
CGGACTCGGAGGCGCGGCGGTTCGACGAGTTCCTGGCGACGACAAGCAGCGTGGACACGGAGGCCTTTGCAGAAGCCGTG
TACCGACGGGTCAAGGAGGTGGAACACATTGGGCGCAAGCTGCAGCGAGACGTGCGCAGTTACCGAGACAAGGCGCATGG
GCTGCAGAAGGAGGCACACGACAAGATTGCGTTCAGGCAGTTCAAGGAGGGTGACCTGGCGCTGTTCCTGCCGACACGCA
ACCAGAGCAGCGGAGCGTGGGCAGCCTTCAACGTGGGTTTTCCGCACTACTTTCTACGAGAGCAGGAGGCGCACCGGCTG
CAGAACCGGGAGTGGCTGGTGGCACGGATCCAACGTGTGCAGGAGAGGGTGGTGGATCTGTCGGGGGGGCGGAGTGGAAA
CGGGAGCCGAAGCGGAGCCGAAGGAGCGACGGAAGAAGACACGGATACGGAAAACGACAACCCGTTTGATCTCTCAGACG
GACTGCGCTGGTACCTGATCGATGCGCAGGAGGACAAACCGGGAGCGCCGGCGACTCCGGGCCTGGGCAAGAGCACGGTG
GCGGGCAACAACGTGGAAGCGACGGCAGCGATGGCAGAGGCGGTTGGTCTGACCGGAAGCGGTGGAAGCGGTGCACGGGG
CCGAGTGCAAGGTCACGGACGAGGCAGTGGCAGTGGCAGTGGCGATATTGCAGGCATTTCGGGCATCAGTGGCAGCATCA
TTCGGTCGGCCGGCATCGAAGGCGTCAGCAAGACACTGTCGCGCAGTCTGGAGAGCCGACGGTCGAGCACGAGCTCACGA
CGGGGAGGTGGAGGACCAGGGCCGTCAGCATTGCGAGTGTTGACAGGAGGAGGTGGTGGAAATGCAATTGGAAGTGCTCC
AGGAACGGCAACTTCAGAAGCCGAAACGGCTCGAAACGGCCAGCTATCTGAGGTACGCAGCATTGTGGACTCGCTGATGG
GGCCCACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62