GenePrediction:GLEAN_7413 Details

Name: GLEAN_7413
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2255452..2254259 (- strand)
Length: 1194
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2255452..2255391 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_140:2255128..2255099 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:2255000..2254979 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_140:2254910..2254671 (- strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_140:2254609..2254259 (- strand)
Length: 351
>GLEAN_7413 class=GenePrediction position=GCSC_140:2255452..2254259 (- strand)
ATGGCCATTGAAATCTCTCGCCTTACTGAGGCAGATATTCCTGGCGCAGTGGCAGCTATCCAGTATGTTAAACGTCCAAC
GCGACCCTGCACGTTGTTGCTCTCCGGGAGACAAGCGTCACATCACAGTCTGCATTTTGACGGTCTACGTCGTAGTGCCT
CCGCCTGAAGCCCAGCGAGCTTCCAGAAGGAAAACGGGACGAAGAAAGCAGGTCTTCGACGAGCTATAGACGGCAGACAG
CGCAGCCTTGCATTGGATATTGTTTTTCTCGTGCAATTAGGCGATCTTGAACCAGTGGCTGACCATTGGCGTGAACGGGC
ACAGGAGAAGCTTCATTGATGATCCTTATGAGGAGTGAGTGACTTCCAGCAAGACCATTTTCGACTTTGCTTCTTTCTTT
CTTCCACCGTCACCTCTTGGGCGAGACAGCTAACGCGCAGGTCGTTCCAAAGATGGATGTATTACCAGTCAACGGTATGC
TCACAGATAGGTCACCTGCTGCAACTGCATTGCTCGATGCTAACGTTGTGCCTCGACATCAGTTCAGCCCGCAACGGAGT
TGCGCATCGCTCACGGCACGGTGTCAACTGGGCATACACAACGAGCTTTTTTATGTGGCCAAGGAAGCGGGCAGCGACAA
GGTTCTTGGTGTGGCGATGTGGCTCCGGCCCCGACCTGAGGGCCAAAAGCTGTCCTGGGTCCAATGGGCAAACTCATGGC
GTTTCTGGTTCTCGCAACTGGCCGTGAACATCTGGCATGGCCGGGGAGGTCTGAATGTTAAGGTATCCCCTCTCGAGTGC
CCCCGATTTACGCAGGGTCTTTCTCGTGTCTAACAAAGGCCAGAGATATTACATCTTCAAGGCAGCACAGGCGCAGGCGA
TCGAGGCCATCTGGATCGAGCCACGTGGCTACTATTTCCTCAACACGATTGCGATAGTGCCAGAGGCCCAGGGCAAGGGC
ATCGGGCGGAAGCTGGTGTCAGTGGTGACGGACAGAGCCGATGCTGAACAGATGCCATGCTATCTCGAGTCGAGCAAGGC
GCAGCCCAATATGGCGATCTACGAGCGATGGGGCTTCCAGTTTGTGAGGGAGCTGACCTGCGACGATGACGGGGCCGTGT
GCAAGCTATATTGCATGGTGAGGAAAGCCCGGCAGAAAGAGGAGGAATTAAGGGGTGAAAGGAAGGCGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62