GenePrediction:GLEAN_7414 Details

Name: GLEAN_7414
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2253369..2251495 (- strand)
Length: 1875
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2253369..2251650 (- strand)
Length: 1720
Type: CDS
Source: GLEAN
Position: GCSC_140:2251568..2251495 (- strand)
Length: 74
>GLEAN_7414 class=GenePrediction position=GCSC_140:2253369..2251495 (- strand)
ATGGCGAGCTCACAGCTGCGCAGCGCCCAGCTGCAGCAGGTGCGGCGGCTGTCGACGATGTCGTCAGGGCTGCGGGCCAG
CATGCTGTCGCGGGCGAGCAGCAGAAGCGCAGTGGGCACAGCATCGAGACTGACGTCAGCGCCAGGATCAGCGGCATTAG
CAGCAGCAACTGCAGTCGGGCGGCGGCCAGCAGCCATGCAGCTGGTGCGACACGCGTCCAGCGGGCCGACAGTGACGAGC
TCGACGACGGTCAAGCCGAAGAAGCGGTTCCGCAAGCTGCGTTGGCTCTGGCGGCTGACCTATCTCTCGGGACTGGGGCT
GGCGGGTTACATTGTGTATTCATTGTGGGAGGACCGGCAGCCGGGCGAGGTGCTGCCGCGGGACCCCAACAAGAAGACGC
TGGTGATCCTGGGGACCGGATGGGGTTCGGTGTCGCTGCTGAAGAAGCTGGACACGGAGAACTACAACGTGGTGGTGATC
TCGCCGCGCAACTATTTTCTGTTCACGCCGCTGCTGCCGTCATGCACGACGGGCCTGATTGAGCACCGGTCGATCATGGA
GCCGATCCGGACGATTGCGCGGACGAAGAACGGGTCGGTGACGTTCTACGAGGCAGAGGCGAGCTCGGTGGACCCGGAGC
GCAAGGTGGTCAAGATCCGGGACGGAGCGGACGTGCGGGGCCGGACGACGGAATCGGAGGTGGCATACGACATGCTGGTG
GTGGGTGTCGGAGCAGAGAACGCGACGTTTGGAATTCCGGGCGTGCTGGAGAACTCGTGCTTCCTCAAGGAGATTGGCGA
CGCGCAGCGGATCCGCAAGAAGATCATGGACTGTGTGGAGACGGCAGCGCTCAAGGACCAGACGTCGGAGGAGATCGACC
GGCTGCTGCACATGGTGGTGGTGGGCGGCGGGCCGACGGGCGTGGAGTTTGCGGGCGAGCTGCACGACTTCTTCGAGGAC
GACATCAAGAAGTTGATTCCGGACATTGCAGATCGGTTCCGCGTGACGCTGATCGAGGCGCTGCCCAACGTGCTGCCGAG
CTTCAGCAAGCAGCTGATCGACTACACCGAGAGCACGTTCAAGGAGGAGGAGATTGCGATCCACACCAAGACCATGGTCA
AGAAGGTGACGGACAAGGCGGTCGAGGCCGAGGCCAGCCGGCCAGACGGTTCCAAGGAGCGCGTCGTCTTTCCCTACGGT
CTGCTCGTGTGGGCCACCGGCAATGCGCTGCGACCGGTCGTGCGCGATCTCATGGGCCGCATCCCGGCGCAGAAGGACTC
GCGTCGCGGCCTGGCCGTGAACGAGTACCTGGTCGTGCAGGGTGCCCGCGACATCTGGGCCGTCGGCGACTGTGCTGTCG
CCGGCTATGCGCCTACAGCCCAGGTGGCCTCGCAGGAGGGCGCCTTTCTGGCCCGCCTGTTCAACAACATGGCCCGAACG
GCTGTGCTGGAAGACCGCGTCCGCACGCTGAGCGCGTCGCTCAACCTGCAGCCCGGCACCGATGCGCCGACGGCCAGCCG
CGAGATCGAAGAGGCCGAGCGCCAGCTGCGCCGCATCAAGGACATCAAGCCCTTCCACTACTCGCACCAGGGCTCGCTGG
CCTACATTGGCAGCGAAAAGGCCGTTGCTGACATTGCCTGGTTCAACGGCAACTTTGCCTCGGGCGGCAGCATGACCTTT
TTGTTCTGGCGGAGCGCCTATCTGTCCATGGTCTTTAGCAGTGAGTTTTTTTTTCTTTTTTCTTTTCTTTTCTTTTCTTT
TCTCGTCTGTTACGTGCTCTCGGCTAACCCCAAACCGACAGGCCGCAACCGTCTGCTGGTGATCAACGACTGGATCAAGT
CCAAGCTCTTCGGCCGCGATATTTCCCGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62