GenePrediction:GLEAN_7418 Details

Name: GLEAN_7418
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2225218..2221206 (- strand)
Length: 4013
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2225218..2224804 (- strand)
Length: 415
Type: CDS
Source: GLEAN
Position: GCSC_140:2224738..2223870 (- strand)
Length: 869
Type: CDS
Source: GLEAN
Position: GCSC_140:2222245..2222156 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_140:2222095..2221280 (- strand)
Length: 816
Type: CDS
Source: GLEAN
Position: GCSC_140:2221211..2221206 (- strand)
Length: 6
>GLEAN_7418 class=GenePrediction position=GCSC_140:2225218..2221206 (- strand)
ATGGACGGCAGTAAGGCAACCACCTCACCGCCTGCGCATCTGGACAGCAGAGGAACCACCACATCCTCCACCTCATCTGC
ACCGCCATTTGCTGTGCCCATGTCTGCTCCTGCAATTCCAAATCTCCTATCCCGACTAGGTGGCGGGCCCCCACGCTCTG
GCCGCGGTGGGCGGCATGCAGGAAGCCGAGGTGGGCTACATGGCCGCAATCACAGGCACGGCCACGGCGGTCATGGCGGT
CATGGTGGTCCGGCTTCCGGCATGGATCACGACACGGTCATCCAGAGCACCGACAGTGACGCCGCCCTCTCCCGGATGAG
TGCTGTCGATCTGGGACTGCTAGATGATCGCTTCGCACGGTTTTTCGTCATCGGTGGCGGTCTAGCTGCCCCCCGGTTAC
CCATCATTAACAGAGGTAGATGTTTACTGTTCCACTCGCTTCTTGATAATGCCACTTACTAAGCTGCTGATTCGTATCAG
GCACGTACACCCGCACGACTGCCCTCGATAAGATTATCGGGTCTTTTCTCTCGGGCGCCGATTCATCTATATCACAGGTA
GCCTTCAGTCCGCCAAGACAGGTAGTCTCCCTTGGTGCTGGAACAGATACGCGCAGCCTACGAATGCTCTCAGGAGATGG
GCCGCAACTCTTCAATACTTCCTACCATGAAATTGATTTCCCAACCGTGTGCGAACGGAAGCGCAACGTATTGCAGTCCG
TGCCCTCCTTGGGAAGCCTCCTTGCGAGCCCCGTTGTCGAAGTTCATACCTCAGCAACAACAGCAGGGATGACCACAGAC
AGCACACATGGCGAAACGATGCACGAGACTTGTTGGCGTGCAGACCTGGGACATGGAAATCAGCTCTGGGGCCACGGTCT
CGATTTGCGCCAGCTGGCGACAGCCGCTGCCAAAGATGAACGGAAAGAGAACAACTGCTCAGCCACGTTGGCCGGACTAC
GTACAGACATTCCTACGTTACTCGTGTCTGAATGCTGCCTCTGCTACCTCCAGGTGCCCGAGGCTCTTGCAGTGCTGCGC
TGGTTCGCTGACCGCATTCCGGACCTGGGTGTCGTCATTTACGAACCCATCGAGCCCAATGATGCCTTCGGCCGAACTAT
GGCAGCCAATTTGTCTACGCGTGGCCTTCACATGCCGACTGTGGCGGTATATGAGAACGGATCTGCACAGGAGATGCGGT
TGCTCAAGCAGGTAGGGCTCGATAAGGCAAGCCATGCATCTATTGAAAAGATCTGGAAGGATTGGGTGCCATCAGAGGAG
AAGGACCGCATCAACGAACTGAACGCCTTGGACGAGGAAGAGGAGTGGCAGCTTCTGGCAAGCCACTATGTTATTGCTTG
GGGCTCGCGGGGAAATTGGATTAGTACATCATGGACAAAAATTTACAACGCATAAAAGGCAGAAGCAAAATTTAGAATAT
GTGTATATGTGCAAAGGTAGAGAAACGAAATACTGGGCAGAGAACCACTTAAAAGTAATACTCGGCGCTCTAGTTGAGCC
TTTGGTGTTAGAAGTTCGCTGAGTCAGCACTGCAGTTGTATCTGATGTAATGACGTTGAGAGTGCACGTGATTTGTATTG
GCGTGCACGGGCCAGTCCTCGTACTCCACATTTCTCATCGCCAACCTCGACTGCGGAAAGCTGACCTTCGTTTCCCCGTA
TTCAAATCAGTCGCGTGCATCTCTCGGTTTTGGGTCGCCTCTCTTTTTTGGTATCGCTCAGCTATTCTGGGTGACGCAGA
AGCTATTTTTGAAGGTCACAGAGCCGTTCGGCCTCACACCCGCGCACAACGCTGCCCACAGAACATTCACGATGGCGGAC
AAAGATGGCAAACAGAACAAATACAAACAGGAGATTCAACAGGTCAGTAACGCATTTTTTTGCAATTTTGTGCTTTGTTC
TATTTGCTCGTCTTTTATAGCCGAAACTGCCATTGCAGGGGAGTTCCGGGATAGCTTCCAAGATGATTTGGACATGCAAC
AAGGGGTCGACGCAAGCCTGGGGAAAGAGTGGTTTGGCCAGTGGCAATACCTTTGGCAAACCCCTAACGGAGCATGTATG
GATATGGAGTAGTACTCCGGTCTACTCTCGGGGAACACGAGCTGTGCATTGGAAGGGTTTGGTTCGGGTAGATGCATGAA
CCTGCCCCAGGGAAAAAGATGAGTGTCTCCTGTTCACATTGAGTTCCATGGAAGTTGATATTATCCATGTATGTTCCAGG
TGGCATAGTTACCACCTTTTCTGCTAAAGGACCAGTAAGAGACATCTGTCGGCCCGACTCGTGACTCCCGACCTCCTGTT
GCCCAGTCTATATTCTGCCTAGGTATCATCCTCATCAAGTGGTCTTGCTTGACCACCGCCCTAAACTTCTTGTTACTACA
AAAGGAAATGGACTGTTTGCATCTCCACTTCTCCACAACACGGTAGAGTATTCAACAGTGAAGTACGTTCGTCAGTACTC
CGTATTTCACATCGAGCCAAATCAACGCAGCGCCATTTTTTCTTGCATACTCTATTTTCTTGCATCTTCGTTTACATATC
TTTTTCTCCCCATTCTACATATGCACCGGTCGACAGGATATGAAGCATCGAATAGTCGAATCGATGCGGATTTTGATAAT
CCTGGCCCTACCCAACAAACCCCCTTCGCTCCCAAGCAAATTTACTACAACTCGAGTCGGTGGGCCATGGGAACCGGCGA
TGAAAGACAGGGCATTCTTCAAAGAACCGACATCGCTCCTGGAAGCTTGTCTTCTACTCTTGCCTCTAAGAGCGTACGCT
CTGCCAAAGTTGGCAGCGGTGGAAGGTGCCGAAAACCAGCTCAGACTATGGAAACCCCCCATCCGACACCTTGTGCAAAA
GCAAATGTGCAATGCCGTGCAATTCGTATAGTGAAAAGGGATGCGGAGGCCATGAGGAGATTTCGGAGTGACTTACGTGA
AGATTTTTTGCAGATGATGTATGTCAGTGGCGAGACTGGCGAACCATCTGTTGAGGCATTGGGTATGATCGAAGAGATTG
TGCGCCAGCAAGTGATTGAACTGGTAAGTTTTCTCCTGGATTTTCGCATGAGTCTTCACAGGCAGAGCTGACTATCGCTC
CAGCTTCGTAGTTGCACAGAACTCGCAGCCCGCCGAGGGTCCCGATCGATCACCATCAATGATCTTATATTTCAGATCCG
CCACGATGCGCCCAAGGTTTCGCGCCTGCGGACTTTCTTGTCTTGGAAGGACGTACGTAAGAATGTAAAGGACTCCGATG
ACAAAGGCGCCGAGGTGGATATTGGCGGCGGCGAAGACGCGGTAGGAGCGCCTATGGCAGGAGCACCGGTAGATGACGCG
ACCAAGAAGAACAAGAAGAACAAGCTGGGCCTTCCGTGGGAGCCGGTGTCGTTTTTCAACCAGGAGGTGCCGGAGCGCGA
GGACGAAGAGGACGAGGAAGAAGAGGAGATGAATTACATCACGCTGCAGCGGCTGCGCAAAGCAGACGAGCGCACCAAAG
CGATGACCAAAGAGGAATACGTGACTTGGTCAGAATACCGACAAGCCTCGTTTACGTATCGTAAGGGCAAGCGGTTCCGT
GAGTGGGCCGGCTTCGGGATCGTGACGGACAGCAAGCCGTCGGACGACATCGTGGACATCCTCGGCTTCCTGACATTTGA
AATGGTGCAGACGCTGACGGAAGAGGCGCTTCGGATCAAGGATCACGAAGATCTGTGGAAGGAGCGCACAGGCGACGAGG
CGCGAGGCAACAAGAAGAGGAAGTTGGCGCAAGGCCTGTTCAACTTGCCTAGCGAAGGACGCTCGCCCGTGGAACCTAAG
CACATCCAGGAGGCATTTCGACGGCTGCAGGCACGCCAGACTAAGTACCGGGCGATGCTCAACTGCACGCGACTGCCGGC
GAAGTCCAGCCTCAAGATTGTAAGTGCCGTTCTTCAAGTCTTAGCTTGCCGAGTTTTCCACGTTCTAACATATGGTGACT
CGTACAGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62