GenePrediction:GLEAN_7419 Details

Name: GLEAN_7419
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2211820..2209410 (- strand)
Length: 2411
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2211820..2211790 (- strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_140:2211427..2209410 (- strand)
Length: 2018
>GLEAN_7419 class=GenePrediction position=GCSC_140:2211820..2209410 (- strand)
ATGTTCTCAACACCACCGCCTCGCGGATCCGGTCCTGCCTCCTAATCAGCAATGTCTACCAGGCCGGCAAGCTTCTTGCC
GTCCATAAAATGCTCATCATGTGGGCAAGACGTTGAGATTTCCATGATGGGGGACCACGTTTGCGAGAAACCGTCAAAAC
GTAGGTTGGGTGATCTGGCCTCCGTCTGTGAGACGATTCCTGATGATTTCACGACTAACTTTTGCTGCAGCTCCAGAACC
GTCTCCCCCTCCGCCATCACAGCCGTTTTTGCCGTATGCTCCCAGAAGTAGCTCACGTCTGCCCCCCCAGGTCGACACAA
TAGCAGCGAGTAAGTTTCGACGCATGCCGCAAGGCCTTCCACCTTTCCTTCCGTGGTGTTGACAGTCTCGCAGACAATGG
TTTCTACCGGCCTGGACAGCTCACTCCTGGCAGCAATGTCAGTGAAGTTGCGTCGCCCAGAACGCCTATGGGTATGCGCA
GTTTTGAGTCACGACCTGGTGACGACTACGGACTGAGGGCGGCCAACGACGAACCCGAGGCTCTCCTGTCTGCCAGCAGT
CCAAACAAGGCGAGCGCGAACGTACTGCAACGCATGGGCACCATTGTCCCAGGGCCATTTGGTGTTAGCCCCAAAGCCAA
CAGCTCACGCACTGCTCCACCCTCAAGGGATGGCGGCAGCGACAGCAAGGCCAAGAGCATCAGCACTGCGAACAATGGTG
GGCCCACGAGCGGCTTCCAGTACGCGACATCAGCCCCGAGCCCTGCGCTGCCCCCACAAATGCAGCGCAATGAGGGCGGC
TATGGCGGTCTAGAGCCTTTGCGCCAGGATGACGGCCTTCCTCGACATGACGGCTTTGAACCGCCACAATTCTCGCGTTC
CGGGACCTTTCCACGGCTAAACGACAATGTCATTGTCTTGCGGACGCCGTCTGCTCCTGCTCTGCGAAAACACCAGTCGT
CGAACAGCGCGCCTTTCAACAACCCGAATGGCAATAACATTGGTGGTGGCGTACCGTCGCGTCTGGGCGGCTTCTCCGGC
GACCGGACGACGAAACAGCTCATGGGACCAGACACATCCCGGCCACCACCACCGCGCACCAGCCTCATCCGGCCGCCCAC
TCGCAGCGGCAGTGGCAATGTGCCGCAAATCAACTTGGCTGCCGAGTTTGGCATCGGGAACCCGTACCACTCGTCATCCG
ATTCCATGTCGTCGACGGTATCAAGCCTTAGTCCTCTCGGTGCGGCGTCTTCCTCGGCTTCGTCGTCGTCCTCGGCTTCT
TCTTTTCACACTTCAACTTCCAGCAACGCCTCCGACCATCACCGGCCTAAGACTGCCAACAGCGATAGCAGCAGTCACCC
GGCTGGTTTTGGCAGTATGGTGTCTGACACCGAAACGATAGCCATCAGCGAGAAGCCCCGGCAGCTCTCCATTCAGGAAC
GCCCAGCCGGGCCACCCACAGCTGACCGCCGGCCGAGCGAGCCCCATGGCAGCACCAACAGCAGCGACAATGACAACATC
AACAACAGCAGCAGCAATAACAACGATGACACGAGAAGGCGAACTCGTCCTCGCTCCCCCCTGGCTTCGCCAATGGGGGG
TAGCAGCAACGATGTCAATAACGCGCCTTTGACACAGGAAAACAAAGAAGCGGAAAGACCTGCATCGCGTAAGCGCAGTG
ATGGCGGCCAAGGAGTCAGCGTGCCTGAAGCCAGCCGCACACGGGATCAGTCCACTGCACCCGCCCCATCTCGCGGCATC
TGCAAGGCGTGTGGTGATCCCATCACGGGAAAGTCCGTGTCTAGCGCGGACGGCCGGCTGACAGGTCGCTACCACAAGGC
CTGCTTTGTGTGCACGACATGCTCAGAGTCGTTCTCTTCAGCCACGTTTTACGTGCACGATGACAAGCCGTACTGCGAGC
AGCACTACCACCGAGTCAACGGCAGCCTGTGCGGAACGTGTGGAGGTGGCATCGAAGGCCAGTACCTGGCCGATGACACC
GACCAGAAGTATCACCCCACCTGCTTTGTTTGTGGAGACTGTCGCATCCCGCTCAGGGACGGCTATTTCGAGGTTGCTGG
CAGGTTCTACTGCGAGCGCGATGCCCGGAGGCGCATCCAGCAGACCTGGGCACCGCCACCCCCGAACTACCGGATGCAGC
CCGGTGGGAATAAATTTATGCCCCCTCGGGGACCACCTGGTCGTCCGGGCATGGGACCTCCGGGTATGGGACCTCCAGGT
ATGGGACCTCCGGGTATGGGACTCCCAAGTGGCCCGGGACATCGCTTTGGACCCGGTGGTATGGGCGGTCTGCCACCACG
GCCGTATTATGGTCAGCCCAACGGCGGCGGCCGTCTTGCGCCTCGCCCAAGGATGGAGAAGCGCATGACACGTCTCGGCA
TGATGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62