GenePrediction:GLEAN_741 Details

Name: GLEAN_741
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1812206..1816360 (+ strand)
Length: 4155
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1812206..1815388 (+ strand)
Length: 3183
Type: CDS
Source: GLEAN
Position: GCSC_97:1815587..1816360 (+ strand)
Length: 774
>GLEAN_741 class=GenePrediction position=GCSC_97:1812206..1816360 (+ strand)
ATGGATTCTCGCCAAGATCCTGTCCGGCGCGTCGTGTCGCCCGCCTTCACGAGCCGCCTGCCGGCCAAGAAGAACAGCTA
TCACTCGCTCCGCACCGCCGCCTCTGAGCAACAGCCTCCGCCAACTCGTACCACCCGTCAGATGACTGCTTCGCCCGGCG
TCATGGCTGACATCTCCGACTTCACCTTTGCCGCGCCTGCTCTGCCAAACGGCTTCTCCCGCCGCTTCTCCACCACCCAC
TCCGCCGAACATCACACTAGCGTCGAAGACCAGCTGTCAAATAACACCACCCCGGGCCAAGGCCTGACAGCACGTGGCCA
TGTTGCTGCTCCTCTTGCAGCCTCCAGCTCGACCGGCCGCACTCGCATCCCACGGCCTTCACTGTCGCCGACCCCTGGCC
AGCAACCCCAGCCACCCCCGCAGAACCCGACCCGCAACGCGTCTGTGCTGCCTACTCCACGTCGCCCTATGAGCGTCACC
GATGCCTATAGGATGGCCGAGGACGAAGACGCCATCAGTGCCGCTGCACAGGGCTCGCCCAGCCCGGCACCTCGTCCCTG
GCGCTCCGGCAACAACGCTGCCAACAACTCCAGTGCCACCAAACATAAGAGCAAGCCTAGCACGCCTCTAGCTGTGACCG
CTGCCGCTGTTGCCATTGCAAGCGCCGGAGCCGGCTCCATCAGCGCCAGCGAGAGCCGCATGGAGCGCATCCTCGCCCAG
TCACCGCTCAGCTTCGGTGGCAGAAGAACGGCTCGGAGACTCGGCGAGCATCAGCCGCAGGCACTGCAAAAACGTGACGA
TAAGAACGGTTCTCGCACCAGCCCTGTGCCTCCCGGTCCCCAGTCTGCCGACATGATGCGTATCCGTTACGAAGAGGACC
AGGTGCGCATGGAGGTTGCCAAGAGCGAGCGCAACGGTCTGTTCTCGCCAAAGGCCCGCGTCATTCCCAAGCCTGCCGCC
ATTCCCAGGCCTATCCCGACTCCCAAGTCTTCGACAAGCAGCCGAGACCGGAGTCGCCGCAGCAGCATCGCCAGTCCGAC
TCCGCCGTCGCCATCGCCGTCGCCGAACGGAGGAGTGCCACCAGCATCGGCAGCACCAACCCCCCCCAGCTCGAGCGGGA
GGCAGTGGGGTGTTCGCAGCCGCCAGGGCAGCTTTCTCAAACGCATGCTCTCTGGGTCAGGAAGAGGCTCGTCCGAAGCA
CTGCATAGCCAGCCGGCATCCATCGCCGCCAGTCTGCCGCCCGAGCAACCGCTGCCGCGCGTGCTGCCGCCGTCGGAGCC
GACAGTCATTCCGGCAAGCCCCTCACCAACCAAGAATCATGCCTGGGACGCCGACGTGGACATGGACTTCACGGCCCGCG
ATTTGATGGTGTCAGATAGCCCTCCTGTCCGGGTCAGAACGGCAGAACAGCCCGCCACCAGCGGCTCCCAGCTCAACGAA
GGAGCAGCACACCCAGAAGCAGAGCGGCCACAAACGTCGCCGTCGGTAATGTCGCCCAACCTGAAGCTGGATAAGATCCG
ACAACTGGAAGTGGAGGTCGACCGGAAGTTCCCTGTTGGAGCAGCCCAGACGGCTGACCACCACCAGCACCAGCAGTACA
CCAGCCGCGAGGTGCCCTTTTCTGTGGCACCGCCTGAGGTGTCGCCCGAAGTGTCGCCTAATCTCGACGCTGATTCCTTC
AAGGGGCCGCTGTCGACCATGTCCGAGGACTCGTCTGAAGAGTCAGACGAGCACTCCCACAACAGCAGCGCCGTTTCGGA
ACGCACCAACAAAAAGATCGACGAGATCCGGGCGCGCGAGATCGAGACCCTGTCTAAGAGAGCTCTCGCCACGGCGCGGT
TGGACGAGATCCGGGAGCGCAACGCAGGATACCGGGCGCCGTCACGGGAGAGCATGGGACAGAGGGCCAGCCAGGAGCAG
CTTCGGACCGTCGAAGAGGTTGCCGCCGAAACTGGAGTCGTTGCCGAAGGGTACGGAAGGCCAGAAGGTGCCGGCAACTT
TCTGGATGTCGAGGGCAAGCGCGTTGCCAAGACGACTGGCTCAGTCCTCCGAGCAAAATCACAGGACCGCAGCCAGGCCG
GTGGCGAGGATGGAAAAAGGGTGGAGGTCGACGGGCTTCGGAAGCTGTCGCCGTTATCTTCGCAGTCGGTGCAGTCGGTG
CACTCGCGAAACGAGTCGCAGGAGCTGCTGCGCTCGCTGGCGCGCGTGACGACGCTGACAAGCCCAACGGGCTCGGGGCC
GGGCAAAGAGCACTCTAAGGAACTGCAACCGGCGCTTAAGAACACCAGAAGGTTGCGGGAGATTAAGAGCGTCAGCAGCC
TGCGCGGTGATGGAGGACTTGAGACGGACACGCTGCGGCCGTCGGTGGGCTTTGCGGGAATGCGGCGAATGTCGTCGGGC
GACACTGTAGCAAAGCGGTCTAGTGTGGCAATCTCGGAGGGCGACGCGCTCGACCGGATCGAAGCGGAGATGAGACTGTT
TGCGCCAGGAGAAAACCACTCGGAGAAAGGGTCGATCCGGGCGCCGTCGCCATTGGATGAGCAAGCAACGGCGGCCATCG
CGGCGATTGTCAACGGTGGCGCTAAGAGCAACGGAGACAAGGTGCTAGCTGATGACGCGACACCGCGGGCGCGCAAGATC
ATCGATCCGCTAATGCAGCCGACGCCACGGGTCACTGGCGCTTATGTGGAGACCCCGATGACGACGAGGACAGAGAGGGT
GCAAGAGACGGTCGAGGAGGCAGAAAAGCAGCAGCCAGTTGGCTACATGGCCTCTCTCTTTCGCAAGAGGGCCAGCAGCA
CTGTCAGCAGCAAGAACGGAAGTGTGGTGACCAGCAGCGTCAGTGCGAGCGAGCTGCGACAACGGTCACGGTCGCTGCCC
CGGGCAGAACGACGGCCGGTGATCAACTCGGCCAAGCCGCCCAGCGCGCACGACGATCTGCTGGAGATCAAGCAGGCGCA
GCAGGCGGACGACCCGACGCTGGACAACTTTGACGAGCTGCTGAGACGGCACGCATCGCAGCGAGGTCCGGAGGCTGAGG
AGGGGGACCGCAACACGGTGACGCCGGAGCGGCTGCGGTGGATGACGAGCTCGGTGACGGCCAGTCTGTTGGACCTCCAG
CGGGCGCGGAGCGGTATCGAGGGGCTGTCGGACCGGGTGTTGCAGGAGAAGATGATAACGGAGGTGGGGGGGAGGGAGAA
TGGGACGGCAAAGGAGGAGGTAGAAGAGGAAGAGGAGGAGGAGGAGATGGTGGAAAAGGTTGAAAACGAGGAGAAGGAGA
AGGAGAAGGAAGAGGAGGAGGCCGAGATGGTGAAGAAGATGGAGAAAGAGGCGGAAGAGGCGAAAGAGGCGGATAAAGAA
GCAATTGTGCCAACGATACAGCACAGACGGCAGAGTGTGGGCTCGAAGCTGGAAAAAGCGGTGGTGCAGTCAGACGCGAG
CGAGAAGAAAGAGGTTGTGGGCTCGGGTGTGGAGGTGAAGATTGAAGCGCCGGACTCGAGGGTGGAGGTGAAGAAAGAGG
TTTTGCGCCCGGAAGTGGAGGAGGTGAAGAAAGAAGTGGCCCCGCAAGCAACGGTGCTGAAAACGACAGACGGGGCAACG
TACGTGCGGATCTCGTTGCCGCGGCTATTTCGACAGGGGCAGTTGACGCTTGTGGGGATGCTGGTTGCAATGGTGGCGGT
GTGGCTGGCGATGGAGGGTACGGTGTGTGCGCTGTACTGCCGGCCTGAGGTGTGTGCAGGCAGTGCGAAGATGTGCGAGT
GGTCGCCCGACGACCCGTCGTTTGGAGCGGCGTTGCCGGTGAAGCTGGACCAGTGGCTGGCGGGTGGACGGGGACGAACG
TTGGCATCGTGGACAGGCGAAGAGCTGGGCGACTGGGCAGCCGATGTGTGGGACACGATCACGGGCACGGACATCCGGCT
GGTCGATCCGACGTACTTTTCGTTTGACGAGAAGCGTCGTCATCGGCGACGGCTGCAGAAGCACGGGCTCGTGGCGCCTT
GGACGGCGCCTGAAGAAGCCCGAGCGAGGCTAGAGGAATGGAGACAAGCCCGAGAGGCGCGCGAGCGGGCGCGTGAGGAG
GGCCGCGACCTGGACGACGACGAGGCCGTCGAGGTGGAGAGCATGCCAGATGATGAGCACGCGGGGTGGTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62