GenePrediction:GLEAN_7420 Details

Name: GLEAN_7420
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2191275..2189692 (- strand)
Length: 1584
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2191275..2191225 (- strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_140:2191176..2191097 (- strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_140:2191024..2189692 (- strand)
Length: 1333
>GLEAN_7420 class=GenePrediction position=GCSC_140:2191275..2189692 (- strand)
ATGGGTGCCTTGCTTTCGATTCCGCTCCTGGCGGTGCCGAGCGTCTCGACGGTTTGTCTCTCTGGTCCCAGCTTGCGATT
AGACCGCTAACACGGCCAGCTGCTCTCGTTTGGTGCCAGCTGTTGCGGTGCGGCAACATGCTCCATGGTCTGCAGTGCCT
GTGGCAAATGCGGCAACAGGTAGGTCTTGTGGGATGTCTCTCGTCTCGTCACACTCTCACGCTTCACTCAACTGCATCCT
GACATAGCCAGCATTGCGACGCGCATCGGCTATGCGCTCATCCTCGTCCTCAACTCGATCCTGGCCTGGATCATGGAAAC
GCCCTGGGCCATCAACAAGCTCGAACATCTTATGCTGGACTACGTCAAGATCAACTGTCCGACCGGTCAGTGCTACGGCT
GGCTGGCCGTGCACCGCATTAATTTTGCCCTCGGGCTCTTCCACCTCATATTTGCCGGCCTGCTCGTCGGCGTGTCCTCG
TCCAAGCATCCGCGCGCGGCCCTGCAGAACGGCTACTGGGGCCCCAAGATCGTTGCCTGGCTCGCCTTTATCGTGCTCTC
CTTTCTGATCCCCGATGCCTTCTTCATCTTCTGGGGCAACTACATCGCGTTCGTCTGCGCCATGCTCTTCCTCGTGCTCG
GCTTGATCCTGCTGGTCGACATGGCTCACTCGTGGGCTGAGTACTGCCTGCAGCAGATCGAGGAAAGCGAGTCGCGCGTG
TGGCGCTACGTGCTCGTCGGCTCGACTCTGGGCATGTACCTCGCCTCCATCGTCATGACGGTGCTGCAGTACGTCTTCTT
CGGCGCCAGCGGTTGCTCTGTCAACCAGACCGCCATTAGCTTCAACCTCGCCTTCCTCGTCCTCGCCTCGGCCGTCTCGG
TTCACCCCCGCGTCCAAGAGCTCAATCCGCGTGCCGGCTTGGCTCAGGCTGCCATGGTCGCAGTCTACTGCACGTACCTG
ACCATGTCGGCCGTGTCGATGAAGCCGGACACCTCCGCCGACAAGCACTGCAACCCACTGCTGCTGGCCCAGGGCACGCG
CACCACGTCCGTCGTCATCGGCGCCATCGTCACCATGTTGACCGTGGCCTGGACCACCACACGGGCTGCAACGAACACCC
TGGGCCTCGGCGGCCACGGTGCCATCCGTTTGCCAGACGACGACGACGAGGACAGCTACTCGTCGCACGACCTGGTCACC
CAGCAGCCGTCGCGCCGGGAGATGCGTGCTGAGGCCCTGCGACGTGCCGTGGCCGAGGGAAGCCTGCCGGCCGATGCGCT
TCTGTCCGACGACGACGATGATGATGACAGCAGTCACGATGGCGGCAATCATACCGGCGACGACGAGCGCAGCAGCACGC
AATACAGCTACACCATGTTCCACATCATCTTCTTCTTGGCCACCGCCTGGGTTGCCACGCTGCTCACCATGAACTACGAG
GACTCGACTAGGGACGGCGACTTTGCCACTGTCGGCCGAACCAACTGGGCTACCTGGGTCAAGATTGTCAGCTCGTGGGT
TTGCTACTCTCTGTACGTTTGGACTCTGGTGGCGCCTATCCTGCTTCCTGGCCGGGACTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62