GenePrediction:GLEAN_7421 Details

Name: GLEAN_7421
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2185034..2183232 (- strand)
Length: 1803
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2185034..2183978 (- strand)
Length: 1057
Type: CDS
Source: GLEAN
Position: GCSC_140:2183917..2183232 (- strand)
Length: 686
>GLEAN_7421 class=GenePrediction position=GCSC_140:2185034..2183232 (- strand)
ATGGCTAGGACAAAGGCTTCGTCCAACTTGCTGAACTTGGTCGAATCAGACTCAGAAGACGATCTAGGAGGAGGTACCGC
AGCAGCAGCAGCAGCAAAAGCGAAAACAGCAAAAGCATCAACGACTACAGCGACAAAGAAAACGACATCCATCCGCGACA
TGCCACCCAAGAAAGGCCGGCAGCAGGCGCCGGCAGCCGCAACGAAAGCGTCAAGCACAGCCAGCAAGATCACGAAGCCA
GCACAGAAGAAGGAGAGCGCGGCAGCGATACGCAGGAGAGCGGCAGCAGCGGAAGCAGCGATTGCAGAGGCAGCAGAAGA
GGCAGCAGCAACCAGCCGACAGGTACTGGCAGACCGGACCAACGAGCAGCTTGCTGAGGCGGTTGCACCGGCCAAAGCCA
AGGGACGGGGACGGACTGGGCGCAAGGCAGCAGCAGCAGCGGCAGCAGTTTCTACAGAGGACGGCGAAGACACAGACGCA
GAGACAGCAGCATCAGCCAAAGCAGAAGAGACAGCAAAAAACCGCGGACGGGGACGGCCCAAGGCTGGTGCACAAGCTGC
CAAGGACAAGGACGAGAACAAAGGCAAAGAGGCGCCCAAGGCCAGCAGGAGGAAAGCAGCAGCAGCGGGGAAGAAGGCAG
CGGTGGAAGAGGAAGACGAGTCGATGGAGCAGGACGAGACAGCAGAGGCAGAAGAGGGCGACGACCAGGACGAAGCAACG
CAGCTCACAGACAGCATGGACATAGACGAGAAGGCCGACGACGAGACGACGATGCACGCACAGACAGAGGCGCCTCCAGC
GACGTCTCAGGCCGGCTTCCAGTCGCCGATGCGTCGCAGCCAACCAGCACAGCGGCCATCGTCAGCGCTGCGAGGAAAAG
GTGTGGCTGTGTCGTCGGAACCATCAGGCGACGCGGCCGTACGGCGACGGCTTGGCGACCTGACCAAGAAGCACGACTCG
CTCGAGGTCCGGTTCCAGAACCTGCGCGACGTTGGCGTGAAGGAGGCCGAGCGCAACTTTGAACGGTTAAAGAGGCAGGG
GGATGAGAGGGTGAAGAGTGAGTGTTTTCTAGTGTATATCTTTTTTTTCTCTCTCTTTCCTGTCGACTGACCTTTAGTCT
CGGACGAGCTGATCGCCAGCCTCAGGGCCGAGCTGGCTACGTACCGGGATCTGGCCAAGGAGGGAGCGCGAGCGAAGCGC
GAGTGGGATGCGTGTGAGGCACGAGCTGCCGAACTGCAAGGACGTGTGGACCAGCTGACGGCAGCGCTGGGCGACGCCAA
GGCCGAGGCGCGGTCGCTGACGACGAAGCTGGCGGCCGCGCGCACGTCGGTGGCCGAGGGCGTGGCGGCTGGGGCTGTGG
CCGGCGTAGTACCGGGCAGTGCGATGAAGAAGATGGCCGGCCACGGTGGTCTGGCAGCCGATCGAGCTGCTGCTGCTGCG
GCAGCCGCGGCCAGTCAGGTCGTCCAGCTCAAGGAGAACCTGTACGGCGACCTGACCGGCCTGCTGGTCTATTCGGCGCG
GCGTGACGGCTCGCGCGAACTGTACGACTGCATCCAGACCGGTCGCAGTGGCAGTCTGCATTTCAAGCTCTGCATCGACA
ACGACAGCAGCCATGGCCGCGACGGCGGCGGCGACGACGACAACGAGTCCCAGTTTGTCTATATGCCGCAGCTCGACGCC
AGCCGTGACGCTGATCTTATCAGCCGGCTGCCCGACTACCTGGTCGAGGAGATCTCGTTTCCGCGGGCGCAGGCGGCCAA
GTTCTACAGCCGCGTGGTGCAGTCGCTGATGGCAGACAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62