GenePrediction:GLEAN_7422 Details

Name: GLEAN_7422
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2176003..2172855 (- strand)
Length: 3149
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2176003..2175993 (- strand)
Length: 11
Type: CDS
Source: GLEAN
Position: GCSC_140:2175915..2175827 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_140:2175766..2174361 (- strand)
Length: 1406
Type: CDS
Source: GLEAN
Position: GCSC_140:2174102..2172855 (- strand)
Length: 1248
>GLEAN_7422 class=GenePrediction position=GCSC_140:2176003..2172855 (- strand)
ATGCAACAGCCGTGAGTTGCCCTTGATAAGGCATCTGATGTCTCCAAGGCGTCTGGTTCTGACAGTCCTGCACTTGACAG
GTTCATAGAATCCAGTCGGGACAGGTGATTGTCAATCTTTGCTCTGTGGCCAAGGAACTGGTCGAGAACAGCATTGATGC
CGGAGCGACGAGCATAGGTAAGTGTCGTCTCTCTAGAGCGAAACATGTCCCTTTGGCGCTGACCGTGTGGACGTCAGAGG
TTCGGTTTAAGAACCAAGGCCTCGACTCGGTCGAGGTGCAGGACAATGGCTATGGGATCTCGACGCAGAACTACGAGGGC
CTCGCGCTGAAGCACTACACGTCCAAGCTGTCCAAGTATGACGACCTGGACACGTTGCAGACGTTTGGCTTCCGCGGCGA
GGCGTTGTCGTCGCTCTGCGCGCTGTCCCACTTTAGCGTGGTGACCTGTCTGGCGGCCGACGTGCCCAAGGGCACGCGGC
TGGACTTTGAGACGTCGGGCCGGCTCAAGGGCACCAGCGTGGTGGCGGCGCAGAAGGGGACGACGGTGACGGTGGAGAAG
CTGTTTTTCAACCTGCCGGTGCGACGGCGCGAGCTCGAGCGCAACGTCAAGCGAGAATGGGGTAAGGTGGTCAGCCTGCT
GAACCAGTACGCCTGCATCCAGACAGGCGTCAAGTTCACCGTGTCACAGCAGCCCAGCAAGGGCAAGCGGGTGGTGCTCT
TCTCGACCAAGGGCAACGCGACGACGCGCGACAATCTGATCAACATCTTTGGCGCCAAGACGATGACGTCGCTGATCCAG
CTCGGCCTGACCATGGAGCTGGAGCTCACGCGCGATGCGCGGGCCAAATGGACGTCTCCGGTCGCAGACGGTGGTGGTGG
CGGCGGCAGCATCCAGGAGATCCGGGTCGAGGGCTACGTGTCCCGGCCTGCTCACGGACAGGGCCGACAGACACCAGACA
GGCAGATGTTCTTTGTCAACGGACGGCCCTGCAAACTGCCGCAGTTTGCGCAGCTCTTCGGCGAGGTGTACCGGACATAC
AACACGTCGCAGGCGCCCTTTATCTTTGCCGACATCCAGCTGGACACCCATCTCTACGACGTCAACGTCAGCCCGGACAA
GCAGACGATTCTGCTGCACGACCAGGGGAAGATGTTGGACAATCTGCGCGAGTCGTTGATCGAGCTGTTTGAGAAGCAGG
AAATCACCATGCCCACGTCGCAGTTGTCGTCGCAGAAGATCACGGCCTTTCGGAAGCCGGCCGCCAGTCAAGCGAGCAGC
CCGTCGAGTGCGCTGGCCGAGAAATCTGATCGCGCTGCTGTTGGCGAGCAAGAGACGCAGCCCAAGGCGAAGTTGTCCAG
GACAACCCAGTCACCTTCATCGCCGCCCAGATCGGGCCATGCTTCCGATGACGAGGAGATTGTGTATCAGCTCGGTCCAC
GGAAGCGAGGCCCTCCTAGCTTTGCCAGAGTTACTATTGGCAACACGACTGTGTCAACTAGTGTGCTTTCGAGCTCGAAG
CGGCTAAAAGTAGGCAGCAGCGACGGTGCGCGAAGACCAATGTCGACGGAGACGCAGTGCAAAACGAGGACAAGGAAAGC
ACTGCCTTCGTTTGGCGGCACTCTGACACAGATGTTCTCATCTGTAGGGGCGCGCAAGGGTGGTTCTAACGGAGCGGAAG
ATGAAGAAGATGAGGGGGGTATAAACGAAGGCGACGAAGATGATGAAGACGAGGGTGATGAAGATGATAAAGAGCAAGAG
GAGGAGGCGAGGACGGAGAAGGTGGAAAAGGAGGGGGAGGAGGAAGAGGGGGAAGGAGAAGAGGAGGACATGGAGGAACA
AGGAGAGGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAGAAAGCGAAGTTGGAAGAAGATATGGGTG
CTGCTCTAGAGGACGAAGCTGGGCAGATGGAAGGCGTGGAGCCAGATGAAATGTCTCAGTCTGGGTCTGACAGGCAAGAA
AAATCGAGTGAGGCTGTACCAATTGGGGACGACGAGGACGAGCAGGAGGGTCCCGAAGACGGCCAAGACCAGGAAGTCGA
CACACGTCGAGCAGAAGGTCCAGAGACGGAAGAGGACAGACGCAGCCAGCTGTTCCTGAAGAGCGGCGGGTCGAAGAAGC
GGTACGAGACGCTGCGGCTGGTGCAGACGGTGCGAGCCAGCGAGGCAGCGATAGAGAAGATGGCGACATCGAGACAGCGA
TGGCGGCTTCCGGGCGGCAGCCGAGAAGAGGTTGAGGGTGCGGGTGCAGCTGGCGACAACGACGGCGACGACGACAGGCT
AGACGAAGGCAACGCCACGGCAGCCGAGGAGAAGCTGGCGCTGACGATTGCCAAGAGCGACTTTGGGCAGATGCGAGTAG
TCGGGCAGTTCAACCTGGGCTTTATCCTGGCGGTGAGGAGAGGAGGAAGAGAAGAGGAAGAAGGGAGGTCGAGGCGGCTG
GACGACGACGAGCTCTTCATCATCGACCAGCACGCGTCTGACGAAAAGTACAACTTTGAGCGGCTGCGGGCGACGACGAC
GCTGCAGTCACAGCGCCTGGTGCAGCCCAAGCGTCTGTCCCTGACGGCCGTCGAGGAGGAGGTCGTGTTCGAGAGCCGCG
CCGTCCTGGCTGCCAACGGCTTTGTCGTCGATGTGGTCGTCGACGGCAGCGAACCGGTCGGCGCCCGCTGTCGCCTGCTG
ACGCTGCCGCTCAGCCGCGAGACCACCTTTGACCTCGGCGATCTGGAGGAGCTGATCGCCCTGCTGGCAGAACATCCAGG
CGCTGCTTATGCCGACAACCTCGACTGCCTCGACCTCTCGCTCTCGCTCTCGTCCACGCCCATCCCTCGTCCCGCCAAGG
TCCGCCGCATGCTCGCCATGCGCGCCTGTCGCAGCAGCATCATGGTCGGCCGTGCTCTCTCCCATCGCCAGATGGCGGCT
GTCCTCGCTCACATGGGCCACATGGACAAGCCCTGGAACTGCCCCCACGGCCGTCCGACCATGCGCCATCTCGGCAGCCT
CGGCCGGGTCTGGGACGGCGGTCGGGGCTGGCACGAAGACGACGTCGTTCAGGCACGGCCTCGACCCGATTGGCCTGCCT
TTTTGAAGAAGAGAAAGGGAATGCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62