GenePrediction:GLEAN_7424 Details

Name: GLEAN_7424
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2165981..2165622 (- strand)
Length: 360
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2165981..2165804 (- strand)
Length: 178
Type: CDS
Source: GLEAN
Position: GCSC_140:2165746..2165622 (- strand)
Length: 125
>GLEAN_7424 class=GenePrediction position=GCSC_140:2165981..2165622 (- strand)
ATGGACGGCGACCGAATGGATATTGTTGATGGACGTCCAGCTCCGGACACTGCCGCCGATGGCGTTGCGGACGACAGCAG
CAGCATGAAAAAGTTGCCAGCATCCTGGGATACTCCCAAGCACCGCGAGGAGAGCGACAAGTTCAAGGACGTCCTTGCCG
ACCAGGGGTTCAATATAGGTAGGCTACTGCCAGACACGTTAAACGATAAGCAACAACCTCTGACTCTGCAAATAGCCGAC
TATGGTGACCCTCTCTCTGCTGATAGACCCATCGGCAAGATCTATAACCGGCCATTTCCTCAGGAGACTGAGGAGCGTTT
GAGGAGCCTTATGGAACGCCTTCAGAATAGCTCAACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62