GenePrediction:GLEAN_7426 Details

Name: GLEAN_7426
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2160488..2157212 (- strand)
Length: 3277
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2160488..2160327 (- strand)
Length: 162
Type: CDS
Source: GLEAN
Position: GCSC_140:2160119..2158771 (- strand)
Length: 1349
Type: CDS
Source: GLEAN
Position: GCSC_140:2158688..2157212 (- strand)
Length: 1477
>GLEAN_7426 class=GenePrediction position=GCSC_140:2160488..2157212 (- strand)
ATGTCTTCGAATAATGGAATTGACGAACGCAGCAGGTCTGCCGCAGCCGATGATGACGGCACGGATCACACCGGCTACGA
CACACCACGCTCTGGCGTCGCTACGCCGCAACCGGACCTCCACGACAAACGCCTGCCGGGAATCATGAGCTACTTCAATC
AGGTTCGTCCTGCTTCTTTTAAACGCCTGCTCTCAGGCACGTTTTCTGCACACTTGGGGTCGTTCTCCAGCACCACCACC
ACCACCACCATTCCCACCACTGCAGCAAGCACTGCAAGCACTGCCAACACCACAACTGCTTCTGCCACCTCCCTTACCTC
CCCGTCGCCTCTTTGCAAACAAGAGGAGGACCACCCTGCTTCTCGGAAGTTGAAGTCGGTTCCGGAGCTGCAGTCCGAGG
CGTCACCAGACGTGCCACCAGAAGCACAGTTGGAAGTGCAGCCAATACGGCAGCGGGTCTCACAACCGAAATCGCAAGCT
GAGGCAGGGACGGAGTGTGCCAGATCGCATCACCAGCTGTCAGCATCAGCATCAGCAATACCGTTACCGACACCGCCACC
ACCACAATTATCGATGAACCCTGACTTACCACTACATGGGGACCTGGCCGGTGACGACAGTCCGCCGCTTTTACCACAAC
AAACCATGGGTCAGCAGAGACTCCCACCATCGACACGGTCGTTGGATCACTCGCCACTTACAGAAGCCGCTGATACTGCC
GCTTCTTCATTGCATCCGTACCCAACACCGCCTGCGTCGGTGCGCGGGACAACTGGATCCAAAGGCGGAGCTGGAATTGG
GAGAGAAGGAGAAGGCGAAGAAGAGGGCAGCAAGAAGGCCAGTGCCAGCAGCGGTGGCGGTGACACTTCTAGCTCTGCAT
GGGAAGCACAGTGGAGCTTCAGCCGCCACAAGAAGAGCACATCTGATGTCCCGGATTCATTACCTCTTGCCGGCGTCGTG
ACACCATCGAGTGTTTTCGCCCGTCACTTTTCAACTCCCTTTATTGCCCCATCAGCTTCTCCCTCAGTTTCCTCTTCTCA
CTATACCCCGGATACGCACGCATCCACTGCCCCAGATACGCCAACGCGTTCAGAATTCCAAGACTTCGACTCAACTGCTT
TGTCATCTTTCTTTCGGTCTGCTTCTGTTGGGCAACTGAAGAAGCTAACAGTAGTGCCACATGAAAAGAGCGGTCAATCC
ACACCTACCCGGTCGCTTTCCACTGCACAACCGACACGGGAAGATGCTTTCGCGAATGCCGGTACCGTTACTGGCGCCGG
TACCGGTAGCGATAACACCACGCTGGAAGCAGATATTCCAGAGGAGATTGAAGACGTCAATCGCACCATGACTTCTACGC
CCACCCCGCCAGGGGCCCAGGCTCCTGCTCCGAAAGGAAGACTCAGAATCAAAATTGCCGAGGCTCGTGGCCTCCGACGA
AGCAGAGACCCGTATGTCGTCGCCGTTTTTCAGCGGAGCGAACTGATTTCGCGCGGCCCCCGCCCTGCTGAGGGCGAAGA
CGTTGCCGCCATTGCCGCCGTCGCTATGGGTGGCATCCCCATCCAACGCCAGGCCAGCGATACCGGCCGCATACCGATGG
CAATTCCCATGCGCAGCCGCCAGAGCAGCAACACGAGCATGACTGACTTCAGCACTTTCCGGACCCGCACCGGCCGGCGC
TCCTTGACAAACCCCAAGTGGGATGCAGAAGCAGTGTTGTATGTTACTATAGCACTCTGTGCTGTCTTCCAATCCATATA
TGGCTTTCGCTGTGGAGGTTGTTACTAATGTGTGTCCTAGCGACGTTGTTGACTCCGATACGTTGGTCGATATATCTGTT
TACGACCATTCGCCCGCTGGAGAAGAATTTCTTGGTCACGTTGACTTCCAGGCTCATGTCTCTGAGAAGGATGGGCCTGT
CCGTGGCTGGTTCCCTCTCCGGGGCCACGCCGACACCGTGGCTGAGAATACTCCGACTGGAGAGATCTATGTGGAGGCTA
TATACCAAAGGACTAACCGGAAACACTACGGACCAGACGACTTTGAGATCCTGAGACTTATCGGCAAGGGAACGTTTGGT
CAGGTGTATCAGGTCAGGAAGAAGGACACAAAGCGCATCTACGCCATGAAGGTACTGTCCAAGAAGAAGATCGTACAGAA
GAAAGAGGTCGCGCACACAGTAGGGGAGCGGAACATTCTAGTACGGACGGCTACCTCGGACTCTCCATTTATCGTCGGCC
TCAAGTTTTCTTTCCAGACACCGTCTGACCTGTACCTGGTGACGGACTACATGTCTGGTGGCGAACTATTTTGGCATCTG
CAGAAGGAAGGTCGGTTCGAGGAAAGTCGTGCCAAATTCTACATTGCAGAGCTGATTCTAGCCATCGAACATCTGCACAA
CAACGACATCGTCTACCGCGATCTCAAGCCAGAAAACATCCTTTTGGACGCCAACGGGCATATCGCGTTGTGCGACTTTG
GTCTGTCCAAGGCGAACTTGACGAAGAACGATACGACAAACACGTTTTGCGGCACCACTGAGTATCTTGCACCGGAGGTG
TTGCTGGACGAGGCCGGCTATACCAAGATGGTTGACTTCTGGTCTCTCGGTGTACTTGTCTTTGAGATGTGCTGTGGTTG
GAGCCCGTTCTATGCCGAGGATACGCAGCAGATGTACAAGAACATCGCTTTCGGCAAGGTCCGCTTCCCGAAGGACACCC
TCTCGGCCGAAGGCCGCAGCTTTGTCAAGGGCCTGCTTAACAGGAACCCGAAGCACCGTCTGGGAGCCACTAAGGATGCC
AGAGAGCTTATGGAGCACCCCTTCTTCCGCGATATCGACTGGAGCGCTCTTTCGAAGAAGCTGATCACGCCGCCGTTCAA
GCCCAAGTTGAAGTCTGACACGGATGTGTCTTACTTTGACCCTGCTTTTACCGACGCCATGGACAAGAGTGGGTCGCTGA
ATGAGCGGGCTGCGGCCCTGGCACGTGGCATCGCTACATCAACACCCCTGTCACCGTCGATGCAGGCAAACTTCAAGGGC
TTCACATTTGTGGACGAGAGTGCTTTGGAGGACCATATGCGCGGCTATGGGGCTAGCTACACTGGAAATGAAGATGACGA
CATGGACGACGGTACCGAACATGGCTCCGGAGAGCGGAGAGACGATGCTGACTGGGATGATATCAACGACATTGACCCAC
GGAGGTCCGACCGTATGAGCGGTGTTGTCCGGAGCAATGATGAGCAGATGTTCGGCAACTCGCACTTCGACATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62