GenePrediction:GLEAN_742 Details

Name: GLEAN_742
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1830162..1831032 (+ strand)
Length: 871
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1830162..1830271 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_97:1830345..1831032 (+ strand)
Length: 688
>GLEAN_742 class=GenePrediction position=GCSC_97:1830162..1831032 (+ strand)
ATGGCTATTGCATACAGTGAAAACCCCGTCATGAATGGCCCGAGCTATTCTTTCTCGGACACACCCAAAGTGCAGGCCCC
GGAAGGTGCGCGGCAACATCGTTTTGACCCGTATGTGCATCTCTCCTCGTTTAATCACCCCCGCCTCTAGTCCTCATTAT
ATACTCACGAAGTCTCAATACAGGTACACCGACAACGGAGGCACTACCCTGGCTATCGCTGGTGCCGACTTCGCCATTGT
AGCCGGCGACACTCGCCATACTGCCGGCTACTCAATCAACAGTCGCTTCTCGCCGAAGGTCTTCAAAATTGGCGGCTCTA
CTGCCGATCAGCACGATGCCAGAATCGTTCTGTCTGTGGTCGGGTTCGCCGCTGACGGCGAAGCGTTGAAGGAGCGTCTC
GACACTATATGCAAGATGTACCGTTACCGTCACGGCAAGCCCATCAGCGTCAATGCATGCGCCAAGCGTCTGTCGACTAT
CCTTTACCAGAAGCGGTTTTTTCCGTACTACACACATGCGATTCTGGGTGGTCTTGACGAAGATGGTATCGGTGCAATTT
ACAGCTACGACCCTGTCGGTAGCTATGAACGAGAGCAATCCCGGGCTGGTGGTGCAGCGGCGAGCTTGATTACGCCTTTC
TTGGACAACCAGGTTAATTTCAAGAACCAATATGTGCCAGGGAGTGGCATTGGCCATGATCTGATGGAGCGGCCGCGCGT
GCCACTGCCACGAAATGATGTGGAGGAGCTGGTTAAGGATGCCTTTGATGGCGCAGTGGAGCGTCATATTGAGGTAGGCG
ACTACCTGCAGATGCTGGTTGTGACAAAGGACGGTATTGAGGAGGTCGTTCTGCCGTTGAAGAAGGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62