GenePrediction:GLEAN_7438 Details

Name: GLEAN_7438
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2104928..2103389 (- strand)
Length: 1540
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2104928..2104829 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_140:2104753..2104636 (- strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_140:2104569..2103810 (- strand)
Length: 760
Type: CDS
Source: GLEAN
Position: GCSC_140:2103745..2103389 (- strand)
Length: 357
>GLEAN_7438 class=GenePrediction position=GCSC_140:2104928..2103389 (- strand)
ATGACGTCTGCCGACCAGGAACTTCCGCCCGGCGAAGCGGCACCGGAGCTGCTCGACGGCCGGCTTTGGGTGGATGGCTG
CTTCGATTTTTTCCACCACGGTTCGTCGCTGCTTTGCTCCCTGTATTTCTGCGATTGCTACATTGGAATCGTAGCCTTCT
GACGTCTTCCTACAGGTCACGCCGGCGCTATTGTCCAGGCGCGCCAGCTTGGTGACGAGCTCTACATCGGCGTCCACTCG
GACGAAGCCATTCTCGAGAATAAGGGGCCAACTGTCATGAACCTAGAGGAGAGGTGAGCATTACTTCAATGGCTGTGGAA
CGTGCCCGGGCCCGCAGCTGCTAACCCTGCCCCTTACAGACTGTCCGCCGTGGATGCGTGTCGTTGGGCGACCCGGTCAG
TCCCCAACGCTCCCTACGTCACCCAACTCGACTGGATTTCGCACTTTGGCTGTCGGTATGTCGTCCACGGAGACGACATC
ACCTCGGACGGCTCCGGCGAGGACTGCTACCGGTTTGTCAAAGCCGCCGAGCGCTTCAAGGTCGTCAAGCGCACGCCCAG
CATCTCCACCACAGACCTCGTCGGCCGGATGCTGCTCTGCACCAAGACGCATTTTATTCGCTCTCTGCAGGCTGCCCTGG
CCGGCAAAGAGGGCCCAGGAACGGACGCAGAGCGCAAGGCCACTGGCGAGGCCATGGCCGAGCGCATTCGCCTCTATGCC
ACCGACGAGACGGCGAAGAACCCGGGCGCCGAAGTGTGGGTGTGGAAGGCCGATCCCCGGGCCACAGCGCCCACCAGCAA
GCCAACCAAGCTGGTGGCTGGCAAGGGCCCGCAGATAGGACAGCGCGTGGTGTACGTGGATGGCGGCTTTGACCTGTTTT
CCAGCGGCCACATTGCGTTTCTACAGCGCGTCCTCAAGGCCGAGGAAGAGCGCGCCCGCGCCGACGGCTGGTACGCGCCC
GAAGCGGTGGCAGAGCGACGTGGCAAGGCGGCCGGAGACTACCCCCCGGCATATGTGGTGGCGGGCGTGCACGACGACGA
GGTGATCAACGAGTGGAAGGGCATCAACTACCCCATCATGAACATCTTTGAGCGGGGGCTCTGCGTTTTGCAATGCAAGG
TACGTCGGCTAGCACTAGCCGAGCAGCTCCCCTTTCTTCTGTCGCAGCTGCTAACCGATTCAGTACGTCGATGCCGTGGT
GTTTGGAGCACCGTTCACCCCGGTCCGTGACTATCTGGCAGCACTGCCATGGGGCATACCGGATGCCGTGTACCACGGCC
CGACGGCGTTTATGCCGCTGACGTACGACCCATACACGGAGCCAAAGGCAATGGGCATCTACCAGCAGGTGGGCCCGCAC
CAGTTTGCCGACGTCAATGCGGAAACGATTGTTGCGCGGATCCTGGCTAGCCGTGACCGGTATGAGGCTCGGCAACGGGC
CAAGGGAGCCAAGTCAGACGTGGAGGAAGCACACAAACGGCGGGAGAAGATGGTCGAGGAACAGCGGCAGAAGGAGGCAG
CAGCAGCGGCCACAACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62