GenePrediction:GLEAN_743 Details

Name: GLEAN_743
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1831860..1836073 (+ strand)
Length: 4214
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1831860..1832211 (+ strand)
Length: 352
Type: CDS
Source: GLEAN
Position: GCSC_97:1832263..1835424 (+ strand)
Length: 3162
Type: CDS
Source: GLEAN
Position: GCSC_97:1835477..1835954 (+ strand)
Length: 478
Type: CDS
Source: GLEAN
Position: GCSC_97:1836049..1836073 (+ strand)
Length: 25
>GLEAN_743 class=GenePrediction position=GCSC_97:1831860..1836073 (+ strand)
ATGCCGTCGCCCTTGAACCCGTTCTTGGCCGCCTTCTTCAGGAGCGCCTTGCCCTCCCAGTGCACACCCATCAGCAACCA
TATTCTGCTTGTTCCTACGACCGAAGTGCTCCTAACCTGCCGCGATGTCGAAACTGGCTTCGGCTTTACGGAGCTTCCGA
ACCCTGAAGAATTTCTTGCCAGCCATGTCATCCGGATGCCCAATGCTCGTGTGGCTGCTGCGGCAGCCAACGCAGCTGGT
GGAAAGGATGGCGTGGTCAATCTCCGGGAGATACGCGGAAAGGCCAAGCCCTATGGGACGTTCAACGGTCGCAGTGTTGT
CATCAAAGACAACATGGTATACAGCAACAAGGGTAGGCATCCATAGTTTTGCTGTGGCTAGACTTTGTCACTAATGCTTT
CAGGATTCAAAACCCTCAACCATGCCATTTTGCTGGGTGACGCCATATGGTACTCCGACGCGCTCGAGCCCAAACCTTGG
CTGATCTACTACTTGTCTCGCCCACTCATCGGATCCTGGGAAGAGGTCAAAATCACACCTGCTATTCTTCCTCTGCCACG
GTTGGAAAATGCGAGTAATGGCATCAACGGTATCTCTTCGACCGGCACGCGCGATACAGCCGGCGCATCCGGCTCTTTCT
CACCCAAGTCTCCAGAGCAGTCACGAGCAAAACAACATGCTGATGACTCTGGTTCGATACCGCGCAAAAAAGATATCAAG
AGCTTCCATGATCTATTGAACCACTTCCCCATAATTGCACGTCAAATGCAGCCGGGTCTCGATAAAATTTTTAGAGAATT
TACTGCAGCTTTCGAACATCGTCTGCCACCACCACCGACGGAAAATCCAACAACACCGGCGAAGACTAGCTATGATAGCA
ACGGCGCTGCGGACAATAGCAAGAGTGGGCCAGCAGGTGCTGAAGGTAGCAGAACGAGCAATTCGGCAAGTGATGCCAAC
AGCTCCAAAAGTGTCAACAGCAGCGATGACCAAGACTCAGAGGTTTTGTTCTCAGAAGATGATGAGCTTGCCATGCGGGC
ATCGTTGGAGTCAGCGATAACAACAGCGATAGACATTTTCCAAGGCGTCGACAAGCAGCAGCTGTCACTGCTCGGTGCAA
CAACAGACTTGACTGGTCCATTGGTAGAGCGCTTGATTGAGCGCTACGTCGTCGAGAATGTTCACCATCTCATTTTCCCA
CGTTTGAGTTCTCTCAAGCGACAAGAAGACTTAGAACTCGAGGCCAAAATCCGTCAGATGGACTGTGTGGACATAACGCA
GCTGGGTATGGATATCGAAGGTGGTTCACGAAAGAAACACGAGGTCACCATTGCTCTTGGCCGGGCTGTGGAGGAATTTC
GTAAAATGGGCGCAGCTATGTGCCCACAGGACATGTTGGCGTTGTTACTGTCTACGGTCAAACTGGTCACCCATTTGACG
AACCTGCCTGACGATCGGGACAGCGGCGGCCAGCCTGGTGCAGCGTCAATGTCTGCCCCTGGCCAAGCGGAAAAGCCTCT
CTTGACGGTCAATGCGGACACGCTCGTCTCATTGCTTCTGTACGTGGTGATCCGAGCACAGCTGCGACATCTCCTCGCAC
GGTTCCTCTACATGCGGCATTTCATTTTCATCGACGATGTTGACAGTGGTGAGATGGGGTACGCACTGAGTACCTTTGAA
GCCGTTCTGCTCTATCTGGTACGCGACTCCAGTGGTTTACGACGCGTGAGCCGAAGGAACAAGGCATTGTGGGAAGCGAC
TGTTAAGGGAAATCTCACGGAGCTGAAAGCGATAATGGAACCTGGTTCAAAAGCTATTGATGAAGACGCCGTATATGACA
AAAACAGAGAAAGACCGAACTTCGGAAATGGCGGCTCGCGACGACCGTCTAGTAGCGGATGGCCGCCGTCTGTGAGCGGG
ATCAGTTTTTCTAGCGGACTCCCTTCTGGTTCATCGGCATCATCACGCCGGTCCTCTATCATCCTGTCTGAGGCTGAGTC
TTTCTCAACTGGAACAGGCCTCAGCCATGTGTTTCCCTTTCAGTCCAACGCCGACAACGATTTCGAGGTGGACGGCTTCC
CACATTTTCCTGTGAAGCGAGTCAAAATGGCAGCCATGGACACTCGCAGCTTGTCCAGTAGCTCCGAGATTTCGTATCGA
TCCCGGGCGACTAGTGTTGCAAGCACGATGGGAAGCGGAGTTGAAGGCGATACATCAGTGGAGCGCCTCGCACAGACACA
CAACTCCTTTGGAGAGTCGTTACTCATGATGGCAGTGCAAAACGAGCGACTCGAGGCGCTCGAATACTTGCTCACCTTGG
AGGAGTATTTCCACCCCAGCTTCGTGTTAGGCGATGTCAACCACGAGGAAACAACGGTTTTGAGTGCGGCAGTGCAACTC
GGTAACAAAGACCTGATCTTGGTTGTGATCCAGTTTCTGGTCAACTCGGCCGAAGTAGACCAGGCCCGCCTCACTGCGTA
CTTCAAATTGCAGGATATCTGGGGTCGCAGTGTGGCACACTACCTCTTCCATGCACCATTTTTAATATCGAAGTTCGGCA
AGATGATGCCGTGGCGGCAGAAGGATAAGAATGGCCAGACACCCCTCTTTGCACTCTGCCGGTCGTATGACCATGCCTCT
TACCACGCCATGGTAGATGAAGGGTTATATATGGCAGCGTCGATACAGACAGATGGTGGTCGGCTGCATGTGGACGACCA
TGTGGATGGGAAAGGAAATACACTACTACATATCGTCAACGATCCACAACTGGCGGTGCGAATCCTACAGCGGTGCGACG
TGGATGTGAACGCTGTCAATGACCGCCGTTTCACGCCGTTAATGGTAGCTAGCAAGTACGGACGCTTTGACATGGTGCGA
ACGCTGTTTTCCGACCCACGCGTGGACTTGGGAGCTAAGGAGCTTCGTGGCCTTACTGCTGTGGAGCTTGCTAAAGACGA
CGATGTTCGGAACAAGATTGACGACCTGACTCTACTGTCTTTACCATCAGAATTGGATGGGCGGACAACGGCGGCGGTTC
GGTCCTACTTTGTTGAGGACGCAAGCGTGCGGTTTGTGCTCAAATCGGGTGCGGCCGTGAGCCCTGTCAGCTATGCTGTC
ACGACTTGCCGGCGGTCCTTGACAGACTTTGAACACTTGACCAAGCTCCTGGCAATTGAAAATCCAGCATCGTGGATTCC
ATCTGTCGCCGGCCTCCGGTCCCCGTTCCAGATCCCGTCAAAGCCAAGCAGAGCGACTCTCAAAGACCTTCAGGTACGGA
TGGATTGGTTTCTCCGGATGATGCTGTTGCATCCGACCTTTTCGACACATGAGATGATGTGGGAGTTTGTCCTTGTACCG
GACATTCAGCCGGACATGATGGCGCAGAGGAGCAAGCTCAAGGCAGAGACGCGGTCAGAGAAAGTACGGGATGAACTGGA
ACCGCTGAAAGATGTCCGCGAGGTGGAGCAGTTTGTGGACCACGCACGTGAACTGGTGCGCAGTGTTAACTACTCAACCA
AAAGCGTGATGCGGCGAACAAACACCCTGAAAATCGCAACTACAGGTATGTGTCCCTTGCAATGAAAAAAAGGGCCAGCG
TTGCTAACATCAGACAGATCTTCACGATGCAGCGGCTTTGATGGCCAGGGAGGTGATCATGCTGGAATTTCTTCCACCAG
GCTACAAAGAGGCCACGGCAATTTACGTGCAAGCATTGGCGGTGCCACAGACCAACGCTCATGGGATGTTTCAGGCAGCG
TTTCTGGCTATCCAGTCAACAGTGGATGCTATACTCGTGGCACTTGAACGGCCACCACGGCTGATCAACCTAATTAACAC
AACGCGAAAGCAGATGGAGCGGAATTACCAGTCGGTGAACCGGTCGACAAGATGGCCGCTCGGGTTGCTGGACGATGCAC
GGCAGCGACTTAATGAGGAACGAGAGGTTCGTGCGCAACAGAGTCGCACGGAGTGCGAGAACCTGTCCAAGGAACTCCGC
TATACACAGCAAACAGTGGCCCAGGAGCTGGCTGGCTGGCAAGACATACACGAACGGGTGGGACGGCGCGCAATACGCGA
GCTGGCACACAAAATGTTAGTGCAAGAGCGAGACCGGCTGGATACTCTAGAGAGGGCGTTACGACGGGTGCGACGAACAG
TGGCGATGGAAGCGGTCGGTTCAATATAGGACTTTCAGCTACGTGGTCACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62