GenePrediction:GLEAN_7440 Details

Name: GLEAN_7440
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2098489..2095133 (- strand)
Length: 3357
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2098489..2096478 (- strand)
Length: 2012
Type: CDS
Source: GLEAN
Position: GCSC_140:2095914..2095860 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_140:2095585..2095133 (- strand)
Length: 453
>GLEAN_7440 class=GenePrediction position=GCSC_140:2098489..2095133 (- strand)
ATGAAAGAAACACAAAAGGGTCTTGAAACCTCGGACCAAAACTGGCCGTACCGTGCTTATGCAACCAACAGCGAGTATGT
TTACCGCCAGCTGCAAAGCTTCCAGCCACAGCTGCATCAAGAGAACATTCAAAGCCCCTCGAGACTTGCAAGTGTCATTT
CTTCATCCTCGCCACGAACCCTCGCAGGTTATGTCGGCAATGCCTCTGCTGCATGGACCCCGACTTACTCTCGGATGTGG
CCTGACACGCCGAGTTATCATGCCAGCGCTACACAGCCTCCGATTATATATCCCTTGCCGGATGTTTCATTTAGTCGTTT
TCCAGAGCCGCAGGACTTCCAGGAAAATAGCCACAGTGTTGTCGGTCATACCCATAGATGCAGTCCTGACTCGAAGCTAC
TGTCACAGGCAGAGGACATGACCTGGCCTAGCCGTCTCTTGGACATGAACTCGCTCATTGATGGCACTGGTAACAGACAG
CATGTCCAAAGCAGCAGCAGCAATGTCAACAGAAGTGGCCAAATTCTCGATACCTCACCCACATTGATGTCGTCGTCGGC
TCCGACACAGTGGAAGACTCCTCTGCAGGAGCTCCACGACTTCCACAACCGGGCCAGATTCGGTCAGACCCCAGTACGGA
GAGACTACATCTCCGGGCAAGACGGTCTCGCTCAGCTGGACGGGGCGACATTTATGGCGTCAAGAAGAGATGAAATTCAG
GGCCAAACTCTCCGCAGTCTGGGACCTGTGGGATCCGGCAGCAGCTCTGAAAGTCTTGGAAGCCTCAGCACCTTTGGCAA
TTTCATCCATCCGCCTTGTGCTGCCTCGACAACCGGAAGCCTCGGACAAGGCTCGTCGCAAGGAAGACAGCAACAGCGGC
AAACAGAGCCTGAAGTGAGGAAGGACGAGACAGGACGCCATGGCGGATCGGAACCGAGTCCTGGTGCTGCCAGTACTGTC
TCGGCTGCCACTGCATCCACTGCATCGACCACGTCTGGTTCTGGCGCAACACCGCCCTGGCCGTCTGCACCCGGGTTCCG
GCCACCGCTGACCGGTTATGAGTTTGAGCTGCAACACGAAGCCAACCTGCGTGAGCTCCAGAGCCAGAAGAGGTGGGCGC
GCCTGCAGCTGAGCTCGTGCAATGAAAACGCGCGTTTCCACCACACGCAGACGACGGGCTGCATCGTGGCCGTCAACGGC
CATATTATCGGGCCCTACAACCCAGACAGTCTCCGCTGTTATGGGACCAGCCCAGAGGTTGTAGGGCTGCGCGTGACCAT
GACGGTGCACGATGGAAGCGAACAGAGCTCGCAGGCCGCAGCGGATGGCGCCGACAACGACAACTCTCCTCTCTTCGACG
AGCCAACGCTCGTGCTGCGATACCAGATTGTCGTGCCGTCCCGCCGGGGAATGACTTCCGGGGCCTCTGGATACCCTGGC
CAGCCCAGCCGCCGAGCACCATCATCGTCAGGCTTGGGCGCTGGCACATCTGCCTCGATGTCCACGACAGCATCATCTGC
GGGAACTACCCATCAACAGGGCCGTCGCCGCCATTTCGCAACCACGGCAATCCCTCTGCGGCGCGGCATCGCCGCTCGGC
CGGGATACCGTCCGCTCGAGGCGGCTGAGGCGGTCAATCGCATCCGCTCCTGGGGCGGGCAGCCGTCACGCGGCGTGTTT
GGAAACGCCTGGTTGGTGCGGCTGGCTATCGAACCAGGTCACGTGCAGCACACGGTTGACAACCGGGCCACGGAACTGTT
GACCGGCTGCGGGCTGGGTGAGAAGGGAGGCGCAGGAAGAGCTGGCTGGTTTTCAGGTGGGCAACAGCAGAATGCGGCGT
CGGTCAGTCCGACCGCCCTCGACTGCATGGTCGCCGTCAACCAGAGCATGAAGGCGTTGGGCCAGCGGGACGGCACGCTG
TCAATCATGCTGTCGAACCACTCGACGCAAAAGCGCATGGCACGACAGTGTCCAGACCTGGTGGCGATGTGGGTGCTGGC
ACAAGAGAACCTGTAAGGCTCTTGAAATTGAGGACATGGGTGTGCACAAATGCTTGTCATTGAGGACTGTGAGGAGATGT
GTTCGATTGAACATTTTGTTCTTGCTCACGATTCTAACCAACCTTCTGTACAACTTTGTAGAGCAACTGTACGACATGGC
CAACAATGGTTCATTGAGCCTATGTGATTACCCACGCGTCTGAATATAGAGAGTGGTGCCATAAGGCCTGTGGTCAGGGA
AGTCGGTGCAGATGGCCCCCTCACTATATTGTGATTCTTATACGGAGTACTCCGTAAATGGTACGGTTTGCATCGTTTTC
TGCCACGACAGTCACGTGACTTTGCATCATGCCGTCCTATCGGACCAAGGTGTTAAGTTGTTTGTGAGGTACTCTGTATG
TACAGAAGACAAATGCAGCAGATAAGTATGTTTTTAACTCGTTTACACTGATCCTTGTTATATTGTAGACACAGCGTCCT
CGAGCAGCCATTTTCAGCGTTCTAGTCTTAATTTTCTGGGATCCACGGGCAGCCAGTAGGCACATTTTGGCTAGAGGTTC
TACACTGTACACTAGGACGAACCCATTTACAACCAACATGCTGTCCCGCTTTACAAAGCAGCTTTGGCAGGTGGCTTGGC
ACGGTACAGGTATCAACGACCTTTCGGTCCTTTGGATCACGTGATGGCATGCGATTAGGATCAAAGGGACTGAAACTATG
GAGAGGAACTGCAGCCAGCAGGGTGGTAACACCCAACACACCAAGGGCTCTCTAGGTTTTCAGGGCCTGGCCTCGCCGGT
TCTCGTCTTAATTGTTTCACTGCCGGTCTCCATAGCAAGTAACTCTAACTCGTCCCCTCCCTCACGACGGAGGATTATCT
TTGGCGTATGTCGTTCGCCCCCAGCCAGAGCTGCTGAAGATTGCAGGCCAAAGTTCCAACTTCGTGTGCAAGCCTCACCA
GGTGGTAGACGCCGGTACGCTGGTGCAACTCTGCAAGACTCCCATCCACGGCGGACTGCTGGCAAACGAGACGGGCACAG
GCAAACCGGCAGCATACCTCCTCGCCCTGGTCATGCAGCAACTCGAAAAGGAGCGGGTGCACGCCGCTGGCACGCCGACC
ATCTTCAAGCCTGCGATGCTTGTCGTCCCAGCCGCCGCCATCGCCCAAGTCGTCAACGAAATCCAAGTGGTTACTGGCGA
CTCTTTCCAGATGGCGGGCAACTACTCCCACCCAGAGGCCATCAACGACGAGTCGGAGAAGCGACTGCGCGCCGGGTGGA
CTGCTGCTTGTACAGTAACGGAAGTTGGTAAGAGTTGCGTCTTGGGCAGGAAGGACACGTGTGGAGGGCACACCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62