GenePrediction:GLEAN_7441 Details

Name: GLEAN_7441
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2089034..2088408 (- strand)
Length: 627
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2089034..2089026 (- strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_140:2088934..2088921 (- strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_140:2088822..2088797 (- strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_140:2088697..2088408 (- strand)
Length: 290
>GLEAN_7441 class=GenePrediction position=GCSC_140:2089034..2088408 (- strand)
ATGAACACGGTGAGTGAATAGCCACAGGGAAGCGGGGCTGAACCGGGAGCGCCACAGCCAGACATTCGCATTGCTGACCC
CGCCGTGTTTCCATGACCAGGTTAAATCTTTCTGGTACGTTGCTTCTTGCCTGGTCTTTTCAGCCGACACTGCCGGCCTG
GTCGTCTGTCCTGGCCGACTCGTCTACGACTGCTAACCCGGTGGCCGAGCAGGTTTGGATGGGGCTCTCTCTGCGCCGGT
AGGCATTTCTGAACCCAGACAGGCGCGGCGCAACGACAAGAAGCAAAGAAAAAAAAGAATCAAGACCGTTTGCCACTAAC
ACCAATTCTCCCTGCAGCCGGCGGTGTCGCGTACGTCTTTGCCAAGCGCAGCATCAATGCTGATCGCATGGCGCGGCTCA
ACGAGCAGCGGCAGCGCAAGTCGATGGCCGAGTCGCTCGAGCGCACGGCGGCCTTCAATGGCGACGCCGCGCGGACGGAC
ACGGCCGGATCGCCCAGCCAGGAATCCAGCTCGGATCCAGCGCCGACAAGACACGCTCCAGCAACCGAAGGGCAGCGGGT
GCTGGAGAAGAGCAAGTACGAGAGTACCGTGCCGTTTCGAAGTACCAAGGGCGACAGGTTCTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62