GenePrediction:GLEAN_7443 Details

Name: GLEAN_7443
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2080407..2078264 (- strand)
Length: 2144
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2080407..2080273 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_140:2080217..2079887 (- strand)
Length: 331
Type: CDS
Source: GLEAN
Position: GCSC_140:2079825..2079748 (- strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_140:2079687..2078264 (- strand)
Length: 1424
>GLEAN_7443 class=GenePrediction position=GCSC_140:2080407..2078264 (- strand)
ATGGCTAGCACAGGCGAAACCGCGCCTGCGTATGGGATCCCGACCAGGAAGCTTGCGGCGCTCGAGCATCCTGCGTTGCT
GAAGACGCTCGACCGGGGCATTGACACGTTGGGGCTGAATGCCGACTACAGGAGGGTGAGCGGTCGCCGGCCTGATGCCA
CATGTCTGACCGGGTTACTAATCTCGCCAGATTGTCAAGCCAGATGGGCCGCACGCGTCGGTGCCCATCTTCTTGCGGCA
CGAGGACCCGTCGTCGAGCGCGCTGGCCTCCCACAACGCAGCATCGCACAACGTCGTTGTGGCCGTGACGCTGCCGAAGA
GGACGGGGAGAAAGCGAAAGAGAGGAGGCCACGGCCCATGGGAAGAGGACGTCTCTGACTCTAATGTGCAGGGTGATGGT
CTGGCAGGGGCGACGCTGAGCCAGCGAGACGGGATGATGCTGAGACGCAAGATGCGCGACAACGCGGGAAAGTATACGGT
CGAAGTGATCGGAACGATCCACCACAGCCACAGATACAGGGGTAAGGGCACATGTTCAGAGCCGTATCTACGGACAGCAG
CAAAGGCTGACACGGGCTGCAGGCCTGTTTGACTTCCAGCAGTCTGTACACGACTCGCAGTTCATGGCCAAGTTCACAGA
GAAGATCCTCCCGGGAGAGCGTAAGTAGAGTCTAATCCATTCCGACCAGACGGTCCGAGCGACAGGCTAACACGGAGCAG
TGTCAAAGATCCGCGAGTTCGAGCTGACGCCAGGAGTGGCGGCGCCGCCAAACGTGGACATACTGCCGCCGCCCTTCTTC
ACGACGCAGACGCTGCCGTTCTCGTATTTTTACAGCCAGAACCCGTTTGTACGCGAGGTTCCGACACACGACGGAGCGAC
GGAGCTGGTCAACTCGACGGTGGGAGCAGCGCTGGGTGGCTACTTTCTCAAGTTCGACGCCGAGCCGGTGCCGGCAGGCC
CGCCACCATCGCTTCCTCCGCTGCAGGGACGACGCAAGAACGCGATCCTGGCAGAGCTGCGGCGGGTGGTGGAGGAGCGG
CCGGTGTGGACACGACGGGGCCTGGTGAACCACATGAGCGAGGCGATGGGGCTGCTGTTCACGGAGAACCGGCTGAAGAC
GTACTTTGCACACGTGTGCTTCCAGTTCAAGGGCGGGCCTTGGCGCGACACGCTGATCCGGTACGGCTTCGACCCACGCA
AGGAGCCGGATGCAGGACGGTACCAGACGCTGCTGTTCAAGCTGCAGCAGCAGACAAGCCGGACGAGCGGGTGCTGGCAC
AGCATCGGGGACGGGGGCCCGACGGGCACGGAATCGCGGCAGGTGACGACACCGCTGACACACGCGAGCGGGCGGCAGGA
CACGCACATCTTTGACGGACGCAGCTACTGTGACGACGGCAAGATCTGGCAGGTGTGCGACATTACGGATCCGATGCTGG
TGGCGATGCTGGCGAGGGCACCACGGCGACCGACATGCGACGTCGTCAGCACGGGCTGGTACCATCAGGGGACGTGGGCC
AAGGCCAAGGCGATGATGAAGGCAAAGCTGATCGCGATCCGGTTTGGGCGCGACGTGGCAGACGAGGCGTACCAGGGGGC
GCTGGCGGTGGCGGACGAGACGCCGCGGCTGGGGGTACGTTCGATCAAGGTGCCGGTGCCGGACCTGCAGCTCACGCCAG
AAGAAGAAGCGGTGACGGCGGTGAAGACGTACCACGGACGGCCGCAGAAGCGGGCGCGGAAACGGGGAGCGACATCGGTG
TCGGTGCCGATTGAGCAGCAGCGAAATGTGACGCGGATGGGAGGGGAGGAGAAAGAGGGGAGAGCAGAAAAAGAAGGAGA
GATAGGGAAGGGAGAGGTGGCGGAAGGGAGAGAGGAAGAAGAGGAGGAAGAGGAGGAAGAGGAAGGAGACTTTGACGAGG
GAGACTATGATGATTACGATGAAATGGAGGATGAGGAAGAGGAAGTGGAAGAGGTGGACGAGGAAGACGAGGAAGACGAG
GAAGAAGAGGAAGAAGAGGAAGAGGAAGAGGAAGAGGAAGAGGAAGAGGAAGAGAAAGAGGAAGAGGAAGAGAAAGAGGA
AGACGACCATAAAGCAGACAGCATCAAGAAGGAGAGCTCTGATCCGATGGATCTGGGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62