GenePrediction:GLEAN_7445 Details

Name: GLEAN_7445
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2075802..2074582 (- strand)
Length: 1221
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2075802..2075706 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:2075640..2074735 (- strand)
Length: 906
Type: CDS
Source: GLEAN
Position: GCSC_140:2074682..2074582 (- strand)
Length: 101
>GLEAN_7445 class=GenePrediction position=GCSC_140:2075802..2074582 (- strand)
ATGACTACTCCCACGCCCGAAGCTTCGATCTCATCGGTCACGTACGAAGAGCTGGACGATCTGGAGGCTGAGTTTGAAGA
CTTTGACGTCGAGCTGCGTGCGTACTTGTTCCTTTTCCTTTTTCCCTTGTCTTCTCTCTTCCTGTCCTGCTAACACGCCC
AGTCTGCATCCAGGCCGCCAAGGAGCGCACGCTGTACGACCGTCGCGCACAGGTCCTCCGTCGCATCCCGCACTTCTGGC
CGCTCGTTCTCGAGCAGGCGCCGCCCGAGATCGATCAGTACGTCCAGCCGCTGGATTCAAACGTCCTGCTGTCGGCCCTG
GAGGATGTCGAGGTCAGCCGGTTCGAGACGGTGGCGGATGGTGGTGCTGGTGCTGGTGCGGGCGACCCGCGCAGCCTCTC
GTTCCGCTTCACCTTTGCGCCCAACGACGTCTTTGAGGATCGCGTGCTGGAGAAGCGCTTTTGGCACCGAACGGCGCCGG
CGACCGGTTGCGGCTGTGACGACGAACCCGGCCATAGCCACGGCCACGGCCATGGTCCCGCTTGGTCTGGTCTCGTCAGC
GAGCCGGTGCCGATTCGCTGGAAGAAGGGCAAGGACCTCACCGACGGCCTGCTCGACCTCGCCGTCAAGGCCTGGAAGGA
CCCCCAGACCAAGACGATTCAGGATGCCCTTCGCGCCAAGTTCGACAAGACCGCTATGGGCGGCGTCAGCTTCTTCGCCT
GGTTCGGCTACGTCGGCCGTCGCATCACCGAGAGCGAGAGCCGTGCTGCCGAAGCCGACTTGCGCGCTGCCCGGCTGGCC
CGTCAGGCCGAAAGGGCCGCGGCCAAGAGCGCCGGCGAAGACAACGCGCAGGCCCACGGAGCCGCCAAGGAAGACGCCAA
GGATGACGGCAAAGACGATGGCGACGACAACGACGACGATGCTGGTGACGATGACGACGATGACGATGACGACGACGACG
ATGACGACGACGACGACGACGGCTACCCCTTCGACATCTTCCCCGACGGTGACACGTTGGCTGTCACACTGGCCGAGGAT
CTGTGGCCCAATGCGATCAAATACTTTAGTAAGCAAAAACGTCTTTCATCTTTCCTTGTTCAATACACTAACACGCCCAG
AACAAGCACAGGAGCTCGATCAGCTGAGCGACGACGACTTTGAGTCTGGGTCGGAAGACGGCGACGACGACCAGCCGCCG
CCAAAGAAGCAGAAAAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62