GenePrediction:GLEAN_7449 Details

Name: GLEAN_7449
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2054710..2053180 (- strand)
Length: 1531
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2054710..2054506 (- strand)
Length: 205
Type: CDS
Source: GLEAN
Position: GCSC_140:2054421..2054077 (- strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_140:2054021..2053670 (- strand)
Length: 352
Type: CDS
Source: GLEAN
Position: GCSC_140:2053620..2053313 (- strand)
Length: 308
Type: CDS
Source: GLEAN
Position: GCSC_140:2053247..2053180 (- strand)
Length: 68
>GLEAN_7449 class=GenePrediction position=GCSC_140:2054710..2053180 (- strand)
ATGGGATCCGTTGTACGTCCGAACAGCGCCGCCTCGCCCTTCAAGGTTCTTGTGGTTGGCGGCTCATACGCAGGCCTTGC
AACTGCCCTCAACCTGTCGGATCTTTGCCAGGGTAGGGATGCACGTGGAGGTTGGGGTGTCGAGAACCCTTGCAAAACAA
TCATCCACACTGATATCACCATCGTTGACGAGCGGGATGGTTTCTGTGAGTCCCCATGATAGCAAGCCTACCCTGCTACC
TTGTCTGCCTCCTCCTGTTACAATGCTTCTTCTCACACTACGATCACAGACAACGTCATTGGATCGCCCCTGGTGTTTGC
CTCTACTGACTACGCCAAGAAGGCGTGGGTTCCCTACGGCGATGTGCCGGCTCTACAGGATGCATCGCATATTCAAATGG
TGCAAGGCAGCGTGACCAACATCGACCTTGCAGCAAAAAAGGCCATGGTCAAGCAGGCCAACAGTAGTGTCCCTGTCACC
TTTGACTATGACTTTGTCGTTGTGGCCTCGGGCCTCCGCCGCATCTTCCCCGTCGTGCCGCAATCGCTCGACAAGGATTC
CTATCTCGCCGAGATCACGCCTCACGTCCAAGCCGTCTCGTCTGCACAGAATGGTGTCCTGGTTGTCGGTGGTGGTAGGT
CGTCGTCTCTTCTCCCCTTGTTCCTACTCTGCTTGCTGACTCATCACAGGTGCTGTCGGTCTCGAGATGGCTGCGGAGCT
CAAATTCGCCCAGCCCCAGGTCAAGGTAACACTGGCACATTCACGCGCACGCCTGCTGTCGTCAGAGCCACTGGACGAGG
TGGTGGGAGCCAAGGTCCTGGAGATGCTGCAGGAGCAGGGAATCGAGGTGCTCCTGGAACATCGCCTGCAGGAGACGCGG
CCGGTTGCTGGCCAGCCTGCCGTGAAGGAGGTGGTCTTCTCCAACGGCCAGACTCTGCGTGTCAACAACGTCATCATGGC
CTTGTCCAATAACCGGCCGACGACAACGTTTCTGCCCACCGAGGCTGTCAACGAGGATGGTTATGTCAAGATCCAGCCAA
GGTAGTCCACACTCTCCTCATTCCTCCCATCATGTTCTGATTCATGACAGCCTCTTCTTTCCCGAAACTGTCCCCAACGC
CGACAGCGCCCTCGCTGCCGGCGACACCGTCGCCTGGTCCGGCGTCAAACGCTTTGGTCGTGCCATACACCAAGCCCACT
ATGCTGCCTGCAACATACACCAGCGCATGCAGCAGATTCTCTTCGATAAGACGCCAGAGTATCTGATCCTCGATCCAGTC
CCGCCGATGATTGGCATTGCCGTGGGTTCTGATGCCATTTCGTACATAAATGGCGGCGAGCTGGAGTCTGGAAAGGCTGT
GGTAGAAAACTTCTTCGGCGACGATCTTGGCTTGTCAAGTAAGTAGCTCATCCTCCTTATCTCTGTATCTCATGAGCCGC
TTTCTCACACCTGGTGTCTGCAGTTTGCTGGAAGTATCTAGGCTTGGAAAAGACATCGAAGGACTTCAAGGGTGAGGCGA
AAAAAGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62