GenePrediction:GLEAN_7450 Details

Name: GLEAN_7450
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2052078..2051765 (- strand)
Length: 314
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2052078..2051915 (- strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_140:2051837..2051765 (- strand)
Length: 73
>GLEAN_7450 class=GenePrediction position=GCSC_140:2052078..2051765 (- strand)
ATGTCTCCCATTGCTCGTGCCGCCATGCGCTCTGCTCGCATTCCGTTGAACAGCTTCAGCCGGACCGCCCCGTCTATGAT
CACCCGGCGGTTGGCCAGCACAACCAAGTCTGCACCTCCCGACTACGGTCGCCTTGCCAAGCATGCTGTTACCAACCTGG
TGGTGTAAGTAACCATATGGCTCTCGTGACAGTGCCTTGACACTTTGGATTGCCACATACTAACTAGTTTCCTCTGGCCA
GATACGTCCCTACAGCTGCAGTAATTCTCGGCTGGCCGTATGTGTGCTACAAGATCTTCGAAGACCGCATGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62