GenePrediction:GLEAN_7451 Details

Name: GLEAN_7451
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2050728..2049496 (- strand)
Length: 1233
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2050728..2049649 (- strand)
Length: 1080
Type: CDS
Source: GLEAN
Position: GCSC_140:2049558..2049496 (- strand)
Length: 63
>GLEAN_7451 class=GenePrediction position=GCSC_140:2050728..2049496 (- strand)
ATGGCGGAAAGCCTCCACAACATCCCGATGGTCATTGACAATGGCTCGGGCACGATACGCGCAGGTTTTGCGGGCGAGGA
GCTGCCCAAGTGCTATTTCCCGTCGTTTGTCGGACGGCCGAAGCACCTGCGCGTGCTGGCTGGTGCGCTCGAGGGCGACT
GGTTCGTCGGGCCGCGGGCGGCAACCGAGCTGCGCGGACTGCTCAAGATCAACTACCCGCTGGAGCATGGTATCGTGACG
GACTGGGACGACATGGAGAAGATCTGGGCATACGTCTACGACGAGGGCCTCAAGGTGCTGAGCGAGGAGCACCCCGTGCT
GCTGACGGAGCCGCCGTTGAATCCGCGCAGCAACCGCGATACTGCGGCTCAGATCCTCTTCGAAACTTTCAACGTCCCGG
CGCTCTACACGTCCATCCAGGCAGTGCTATCGCTGTACGCGAGCGGCCGCACCACCGGCATCGTTCTGGATGCTGGCGAC
GGCGTCAGCCACGCCGTGCCTGTCTACGAGGGCTTCGCCATCACTAACTCGATCCAGCGCATCGATGTGGCCGGCCGCGA
CGTCACCGAGTATCTGCAGACGCTCTTGCGCAAGAGTGGCTATGTCTTCCACACCAGTGCCGAGAAGGAGGTCGTGCGCC
ACATCAAGGAGGCCACCAGCTACATCGCCCTCGACCCCAAGAAGGAGGAGAAGGACTTTATGACGGCCAAGTCGGATCCA
AAACGGACTGCCGAGTTTGTCCTGCCCGATGGCAACAAGCTGAAGGTCGGCGCTGAACGCTTCCGTGCACCCGAGATTCT
CTTTGAGCCCGAGCTCATCGGACTGGAGTACCCCGGCGTGCACCAGATGGTGGTCGACGGCATTGTGCGCACGGATCTGG
ACCTGCGCAAGTCGCTGTATGCCAACATCGTGCTGTCCGGCGGGACGACGCTGACCAAGGGCTTTGGTGATCGGCTACTG
CATGAGATCCGCAAAATTGCCGTCAAGGACATGCGGATCAAGATCTTTGCACCGCCAGAGCGCAAGTACACGACCTGGAT
CGGTGGAAGCATCCTGGCTGGTTTAAGCACCTTCAGAAAGGTCGGCAATCCTCTGTTTTCTCTTTCTCTCTCTCTCTCTC
TCTCTCTATTCCCTCTCCCCTCACGCGAATCATACTAATTGTCTCCGTAGATGTGGGTCAGCATTGACGACTGGCACGAA
AACCCTGACATTATCCACACAAAGTTCACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62