GenePrediction:GLEAN_7452 Details

Name: GLEAN_7452
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2034808..2032492 (- strand)
Length: 2317
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2034808..2034757 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_140:2034696..2034479 (- strand)
Length: 218
Type: CDS
Source: GLEAN
Position: GCSC_140:2034378..2034185 (- strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_140:2034120..2033402 (- strand)
Length: 719
Type: CDS
Source: GLEAN
Position: GCSC_140:2033345..2032492 (- strand)
Length: 854
>GLEAN_7452 class=GenePrediction position=GCSC_140:2034808..2032492 (- strand)
ATGTCCGCTGCGACGGAGGACAAGCCTTCTGCGACGACCAAATATGAGTCGAGTAGGTGCTCATTTTCCTTCGGAATATC
GTCTTATATAACTTGTATCTAACTCTAGGCAGTCGTTATCACCCTAGCTCAGAACGATGCTACCTCTCTCGAAGCGTCGG
CCCTCCCCATCCGACGTATTTGCTTCTCGCCATCAAAACCGAAGGTACAGATCGGAAGGTCGTCGAAGACTGTCAGCAAG
GGCCTTTCGCCGTCCGAGAACAATGCCTATTTCGACAGTCCCGTCATGTCTCGAGCACATGCCGAGTTGACTGCGGACTT
GGACAAAGGGGTAAGCAATTCAGAGCCTTAAATGTCTCTCAGGGACGTCATGTCCTGAACGGTTGCGTTCTATTAACGTT
AGGGAAGCAAGCTAATCAGGGTTTCATCAGAAAATTCATCTTAAAGATCTAGGCTCGTTGCACGGCACCTCCGTCAACAA
GACAACACTGTCCGACGAGTCCACCGTTTCTCTAAAAGTCGGCGACTCTGTCTGCTTCGGCATCCATGTTGCTCGAGGCC
TAGAGGTTTTTAGCCCCGCAACGGTGATTGTTGAGTCTATTTTCCACATGGTGTCGTCCAACGTGTCAGTTACCCTTCTT
AAGTGTTCCTGGTGTGTTTCTCTACCCTTCTCTACTAACACCTTTCAGGCCTAAGACTGCACAGCCGAAAACGTATCGGG
CACCAGAACCCACTGATGAGTTATCTGATGGAGGCAGCGAGTGCGATTGTTCAGGTAGCGACTATCATTCAAACCTCGAA
GATTCTTCTGGCGACAAAGACGACCAGTCGGATGATGCAGCGATGGACAGTGTGCTCCACACATCGTCAGAAAGTGACGG
AGAGATCGCGGATGTTGCACTGCCTGTATCCAAAACTACAAGCGAAGACTCGGCGAAAGTAATTGAGGCATCGCTGGTGG
AGGCGAGCCTTTTTGACGAAACAGTTGACCAGTCACCTGACGACTTGTTGAGCTATGGCGAAGCTGGGAGTGTTTCTGGG
AGTAGTGACGCGGACGCAATCGAGCTCGACTACAATGAAGATGAACATGTCGACCTGGCAGGCAATGACAATTCTGATGA
TGACAGCTTTATGACGGACAGCGAAGAAGACGAAGAAAAAGACGACGACTTTGATGGCAGCAGCCAGGATGGCTTGGACG
GCGACGATGCTATGGACGTTGACGATGCCGATGACATGAACGACGACGGCAGTGACTTCTTGAGCTCCGAGATCTCTCTG
CTTGATTCCCCAGCGACCAGACCTACCACCTGGGTCCCAGAAACTACTCCTGCCGATGGCTTATGGACACCGCCGTCTGC
CTCGATTGCAAGCCCGTCTGATAGGAAGGAAACTTCGAAGAATATTGGTATGTGTGTTGTTTCTCCTTTGCATGCTACTG
TGCTAATATAAATCTGTATTTAGCCCACGACGCGGCAGACGATCGGATGGAGGATGGCGAGGCCGCCGCCGATAACAACA
CCGATGACAATCATGTTGTTTCCTGTAACGATGCGCTACTCAACGTGGCGAAGAAGTGTAACATCTCTTCTATTCTCAAT
CCATCCCCGCCGCCATCGTCGCCTGTCAGGGAAGCGTCTGGAAAGGCCGTGGCGACTGAAGTTGCCCCTATGGAGCCAGT
CGAGGAAAGTCTGACTTCGGCTTACCTCGAGGCTCTCTACCACGTCAGTTACGTAGCAGGTGGCAGCAACCAAAAGATGG
ACACGGACATTGTTTTGGCAACGCGCTCATCCCCCAACAATCTCCACGCCTCGCCCGATGCTCCGGTATCTGCAAACATC
ACGTCTTCTGATTTCTCAAAGCCCGTTGCCACTACTGCACTTCTCGAGTCTGGCAAAGCGTTCCTATGCTCCTACCCGAA
CGAGCCCGCAAGCTTTATTGACGTCGTCGACGTCGTCGAAGATGAGAATGGCGACGCCATGTTGAGTGCGGCTGTCTTCA
ATGCTCTTAAAAAGAAAATGGAGGCAACCAACAAGAAGCGCAAGGTGGACGAGATGTTGGCAGTACCTGAAGATGTGCCT
GTGGCTATGGATAGTGCACTGACTGGATCTTCTTCGGACAGTTTGGGCAACGGAACTCACGGCGACAGTGGGTCGGCTAT
TCAGTCGCCTCCTAAACGCCAGGCCACAGAAGCTGCTGTGCAGTCCAACAGAAAATTGAAGGGGACAATGTGGGCAGTTG
CTGAGAAAATTGGTATTGCTGCTCTGGGTGGTGCTGTAGTTCTGGGGTCTCTGATTTACACTGCCCCCTCTCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62