GenePrediction:GLEAN_7453 Details

Name: GLEAN_7453
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2029597..2027828 (- strand)
Length: 1770
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2029597..2029568 (- strand)
Length: 30
Type: CDS
Source: GLEAN
Position: GCSC_140:2028971..2028336 (- strand)
Length: 636
Type: CDS
Source: GLEAN
Position: GCSC_140:2028241..2027828 (- strand)
Length: 414
>GLEAN_7453 class=GenePrediction position=GCSC_140:2029597..2027828 (- strand)
ATGCTCATGGTAGGCAACAGTAGCTACAGTGTAAGTGACGCGTACCAACTAGCCACGCTGCCATCTTTATAACCGTCAGA
AATGTGTAAGATTTGGGCTATCATGTAAATATGACCTGTCATATTACCAGCGTAGGTCTTGAGGGTATACAGAGATCTTC
TACGCAGTATCCGTCTGTGCAGGTGCACAGATTGCAGATGCGATGCAGCCAGAACATGCCAATACGGATACGGGTGGCTA
CATATAAACATCTGAGATCACTGACACACTTGTGACTGGGGACATGTCGTTTCAGGTCCATATTACCTTTTGCATACGCG
AACTTGTTGTCGTTATTTTCTAGTCTTTCTCCGTCAGGGCGTTGCTGGTGTAAGTGATCACGTGATATACAAGCCACGAA
ACATGACTAAGCAAACAGCCAGCGCAGGTAATTGGGAGCTTTGGAAATTCCCCACCTCCCATAGCCACAAGCGATCACAG
CTGGCGACGTTCTCCTCTGCTACCAGAACGGACATTTGACGAAAGCCAGAATGTCGGTCATTCTATGCACAGGTGGGCCA
TTTCCAGGTCCCGGAATTGGGGAGATGTCTGTGGAGAGACGCAGCTAATAGACCGCGGGAAATCAGCCGGTTACGACCAC
ACGATCCGGTAAGAAGGCTGACTGTTCTTCGAGCCTCAGCGAAACAGCCGCTGACGGCGTGCTACCCGACACCCCCCCGC
CCCCTAGACCGAACTGGAGCCCAGAGGCTGACGGAGGTGCTGACAGGTTTTGGGAGGCACTGTCGGGCATCTGCTCGCGT
ACCATTCAGCACCCAGATTCGCAGGTGAATCGGCTATGCATCTCGCCAGACAAGCGGTTTCTGGCGGCGGCGGGCCACCA
CACGGTCAAGCTTTTCGACATCAAGTCGACCAACCCGAATCCGCTTCTGGTCTTTGAGGGACACACGACCAACGTGACGG
GCGTGGCATTCCACTGCGAGGGAAAATGGATGGTGACGAGCTCCGAGGACGGCACGGTCAAGATCTGGGACACGCGCACA
GCCATGATCCAGCGGTCGTACAGTCATGGCTGTCCGGTCAACGACGTGGTGATCCATCCAAACCAGGGTGAGATCATTAG
CTGCGACCGCGGCGGCAGCATTCGCGTGTGGGACCTGTCCGAGAACAATTGCACACACGAGCTGATCCCGGAGGAGGACG
TGTCGGTGGCCTGCGTGACTATGGGGATCGAGGGCTATCTGCTCTGCGCAGCGAACAACAATGTGAGAATGGTGGCGAAT
CGGAGAGGGAGGGGGGGAGCGAGAAGAGAGAGAGAAAGAGAAAGAAAGAAAGAAGGCGCGGCTGACTTTTCCTTAGGGCA
ACGTCTTCATCTGGCAGATGTTACCAATGTACGAACGAACGAAACCGGTTCCGATCACGCAATTCAACGCCCACAAGGAG
TTCATCACGCGCATCTTGCTGTCGCCCGACGGCAAGCGGCTGGCTACGTGCAGCGCCGACCACACGGCCAAGATCTGGGA
GGTGGACACGACGCCGCTGGCCCCCGACGAGACGCCCAAGCCGCTCGTGCTCAACGCCACGCTCAGCCAGCACCAGCGCT
GGGTGTGGGACTGCGCCTTCAGCGCCGATTCGGCCTATCTGGTCACCGCCTCGTCCGACCACTACGCCCGCCTGTGGGAG
CTGCACAGCCAGCAGGTCATCCGGCAGTACAACGGCCACCATCGCGGTGCCGTTTGCGTGGCCTTGAACGACTACTCCGA
CACGCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62