GenePrediction:GLEAN_7456 Details

Name: GLEAN_7456
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1991428..1990417 (- strand)
Length: 1012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1991428..1991423 (- strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_140:1991365..1990991 (- strand)
Length: 375
Type: CDS
Source: GLEAN
Position: GCSC_140:1990920..1990417 (- strand)
Length: 504
>GLEAN_7456 class=GenePrediction position=GCSC_140:1991428..1990417 (- strand)
ATGCTTGTACGTATAGACACAGTGAAATTTTGCGCAAGCATTGCATAGCTAATTGTCACTCAGCGCAAAACCGTTCGGCA
GCGGAGAGATTATCTCTACCGCAAGGCTATGATCTTGAAAGAAGCCGAAATTAACGAAAAGCGCGCGAAACTGCGGAACG
CCATCGCTCAAGGTCGGCCGCTTGAAAAGAGCATTGCGAGCGACAAAGCCCTCAGGAAAGATTTTGCCTACGACGAGTCA
CGTCCAGATCTGAATGCGGATGAGCAATTGGATCTCGATGACGAATATGCGCAGTTGAGCGGCCTTGTCGACCCCCGAGT
GCTGGTGACGACGTCGCGGTCCTCGTCTACACGCTTGACAGCGTTCAGCAAAGAAATGCGGCTGTTATTGCCGACATCCA
TTCGATTAAATCGCGGCAACATGATTTTGGATGATTGTGTGCGGTCCGCAAAGGCGGCTGGACTGACGGACATTGTGTTG
CTTTCTGAGCATCGTGGTACCCCTACAGGACTTGTGTATGCTCTTCCCACCAAACTATCTCATGTACGAGGACCTCACTG
ACAACGGCCGCAGCATCTCGCATCTGCCTCATGGCCCGACAGTCTCGTTTTCGCTTCACAACGTCCTCATGCGCGGCGAT
ATCCCCGGCAGCATTCGCGGAAGCGTCTCCGAAGCGTATCCTCATCTCATCTTTGAAGGCTTCACGAGCCGCCTGGGCAA
CCGGATCTGCAAGGTGCTCAAACACCTGTTTCCGCCTCGCGACCCCATCACCAGCAAAACAAAGCTATCAAACCGGGTTG
TAGTGTTCAAGAATATCGAGGACGTCATTGAGTTACGGCACTATGTTTATGTAAAAACTGCATACGACAAAGTGGAGTTG
TCGGAGGTGGGACCTCGGATGTCGATGAAGCTCTTTGAGGTTCGCAACGGCACGCTTGAGAATAAGGATGGCCACGTTGA
GTGGCACCTGAACCAGTTCACGCGGACAAGTCGGAAGAAGGACTACCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62