GenePrediction:GLEAN_7457 Details

Name: GLEAN_7457
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1988951..1987814 (- strand)
Length: 1138
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1988951..1988826 (- strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_140:1988733..1988233 (- strand)
Length: 501
Type: CDS
Source: GLEAN
Position: GCSC_140:1988161..1987814 (- strand)
Length: 348
>GLEAN_7457 class=GenePrediction position=GCSC_140:1988951..1987814 (- strand)
ATGTCTTACAGCAACAACACCTACCAGGCCCAGAGCCCGTACGAGACTGAAAATCAATACAGTCAATACCAGGGAAACCC
GTATGAGCAGACACCAGGCGCCGAGACTGGCAATGGCTACGGACAGGTACGTCTTGACTTCGGCTGCACTGGCCGTTACG
CGCCGACGTGCTTTGTCTTTTCCTACGACTAACATCTTGCCTTTGTCTCTTTGTCTAGCCAGAGCAACATGAAATGCAGC
CGTATGGGCAGCCAGCGAATGCCGGTGCACCCGTCATGACGCAGCAGGAATACTTGGCGCAGGTGTCAAGCGTGCGCGGC
GAGATCCGATCCCTGACGACGAGCGTGCAGTCGATTGCCGGCCTGCACCAGCGCGCCCTGGGTGGCAACGAGCCGGGCGC
AGCACAGCAGTTGGAGCAGCTGGTGGCGCAGACGCAGCTTAAGAACACACAGATCCGCAACCAGTTGCGGCTGCTGCAGC
GCGACTGCGAGCGTACGACCGACAGCCTGCATGCGCTCAAGAAGCGCCAATTCGAGACGCTCAACAACGACTTCAAGAAG
GAGCTCCAGAGCTACATGAACGAGGAGAAACAGTACCGTGAAACCTACCGCGAGCAGATCGCCCGCCAGTACCGCATCGT
CAACCCGGAAGCTACCGAGACAGAAGTCGCGCAGGCCGCCGATGCCGACTGGGGCAGCGAAGGCATCTTCCAGACTGCAG
TAAGCCCTACCCATGGCTGTGCCTACTATCGGCCTACTTGTATTGCATCCTGTGACTAACGTGCTTCTAGCTCCGGACAA
ACCGGTCTGGCCAGGCTACGGCTGTGCTCGGGGCTGTGCGTGCGCGGCACAACGAGCTGCAGCGCATCGAACAGTCCATC
ACGGAGCTGAACGGCTTGTTCAATGACCTCGATACCCTCGTCATCCAGCAGGACCCCGTCTTCAGCCAAGTCGAGGACCA
AACGCAGAACGCCGTTGGCAACCTCGAGAGTGCCAACAAGCAAGTCGAGAAGGCCACAAAGTCTGCTCGCAACCGACGCA
AGCTCAAGTGGTTCTGCCTGTTGGTGGTCGTACTCATTATCATCGCTATTGCGCTTGGTGTTGGTCTGGGTGTCGCCTTG
AACAAGAACAACAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62