GenePrediction:GLEAN_7458 Details

Name: GLEAN_7458
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1984366..1983402 (- strand)
Length: 965
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1984366..1983588 (- strand)
Length: 779
Type: CDS
Source: GLEAN
Position: GCSC_140:1983513..1983402 (- strand)
Length: 112
>GLEAN_7458 class=GenePrediction position=GCSC_140:1984366..1983402 (- strand)
ATGCCTGATGATAGCAGCTTTGAGCTGTTCAGCTCTGTGCGGTATGATGATGCCTTGAGAGACTTACCTCAAAAGTCGGC
ATTTGCCTATGGCGGATGGAATACAAGGCAGTCTTCGCCCTTTTACATGCTGGACTTTCACCGGGATCGCCTTCTCCGAG
CTGCAGAGCATTGGGAATGGGAGGATGCCGCAGCAACCATCACCGGGGACGATGGCTTGCAAAGGCTGGAGCGCGTCCTT
CAGAGCTCGGTTGATGGCCATACACTAAATAATGGCGATGGGCCTCTGCGGTGCCGCGTCGCCCTAAACATGAATGGCAG
GTTGCACTGCAGTGTATTTGCGGCACAAGAAACGGCGCTCGTCGGGCTCGTCCCGCCACAGCTTCCACCACCTGGGTTTA
TGGCTAGTTCCTGCGACGGTAAGGGAGAGACACAGTTGTTGTTCCCGCTGTTGCGGTCATTGCGGTCAGAGTTGGGACCT
CAGCCGTACGAGGTATCGATCGATTTGGACGGCATTGCAGCTTCTGCGTATACACACTACAAGACAACTCGGCGACAGAT
GTATGATGACGCTCGTCAGCGGGCAGGAATAACCGGTCCTGAACAGAAGGAAGTGCTCTTAATCAATGCAGAATCCGGGA
TGATCATGGACGGCAGCATCAGTACGGTATACTTTTGGCGTCATGGCCGCTGGGTAACACCTCCAGTTCCCTCAATATAC
GACCGAGATGCTGGTAGTGGTGGTCTGGATGGGACCACACGAAGATGGGCTCTTGAACAGTAAGTTTGTTTTTGGTCGAA
CGACATATTTGCATGCTTCACAACTGATCATAACCTTTCTCATTTATATATAGTAGGCTTGCTGTGCAGGAAGAGGTCAA
GGCTGCATCAGTGCTTGATGGTGAAGAATGCTGGTTGAGTAACGGCGTTCGAGGATTTCTGTATGGTAAAATCAAGATTT
TGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62