GenePrediction:GLEAN_745 Details

Name: GLEAN_745
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1842741..1844307 (+ strand)
Length: 1567
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1842741..1842812 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_97:1842871..1842942 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_97:1842998..1843483 (+ strand)
Length: 486
Type: CDS
Source: GLEAN
Position: GCSC_97:1843756..1844307 (+ strand)
Length: 552
>GLEAN_745 class=GenePrediction position=GCSC_97:1842741..1844307 (+ strand)
ATGCCTCCGAAAGAAGTCGCTGTTGAGGAGATCCTGCTTGGTCGGCCAGGAAACAGCTTGAAGAGTGGTATTGTAAGAGA
AGTCCGGTTTGTCTGCATTCTTGTAATTGCATGCTAATAATTTCCAATAGGTCGGGCTTGCCAATGTCGGAAAATCTACT
CTTTTTCAGGCTATCACCAAGTCCAATCTTGGAAACCCTGCTGTTAGTGGCACTCATCCAGCGGTTTCCGTTGGATTTAA
ACTGATCGATTTACCAGAATTTCCCATACGCCACAATCGACCCGGAAGAGGCTCGGGTTATCGTACCGGATGCTAGATTT
GACTGGCTATGCGAGAAGTACCAGCCCAAATCTCGAGTGCCTGCCAATCTCACGGTATATGATATTGCTGGTCTGACACG
TGGTGCATCTACCGGTGCTGGTCTCGGTAATGCATTTTTGTCACATATTCGTGCTGTCGATGCTATTTTCCAGGTTGTCC
GGTGTTTCGATGACGCTGAAATTATTCACGTGGAGGGCGACGTCAACCCAGTCCGTGATCTTGAGATTATCCGAGAGGAG
TTACAACTCAAGGATATAGAATTTGTCGAGAAGGCGCTCGAGAATCAAAAGAAAAAGACTCGGCAAGGCGGCCAGAGCTT
GGAACAGAAGAAAGCTCGTGAGGAAGAGGCAACTATCGAGAAAATTCTTGCCTGGCTGAAGGCCGGAAACGACGTCCGGA
AAGGCAAATGGACTCCAAAGGAGGTAAGCTTTTACAATATATCCGTGTCCTTTTCAACATTTTCTTCTTTTTTTCTTTTT
GCACCCTTTACCAGCATCTACGTGATGATAAAAGGCCATAGTGCCTGATCTCTTAAACCCAGCTCGTCGAGTGCTATCCA
TGATTTTCGTGGAGAGCACTATGAGATAAGAACATATCTGATTTTACTGCTGCTCACCATTGCTTTTTCAACGCTTTTAT
TCCAGACAAGTCGTCTCAAAAAGTTCGAGATTACGAAATACTAATAAACATACAGGTCGAAGTGATTAACCCTTTAACTT
TGCTGACAGCCAAGTCCGTTGTGTTCCTCATTAACATGTCTGAGAAAGACTTTGTTCGTGGCAAGAACAAGCACCTGGCC
AAAACTGCTGAGTGGTTGAAGAAGAACGCACAAGGCGATCCGGTTATTCCACTATCCGTCTCTTTTGAGGAACGCCTCAC
ACACCTGGAAACCGAAAAAGAGGCTCTTGAGGAGTGCCAACGGCTGGGTGTGAAGTCTAAGCTGCCAGATATTATCGTTA
AGATGCGTGAGGTACTCAGACTCGGCAGCTTCTTCACTTCTGGTGCCGATGAGGTTCGCCAATGGACAATTCGGAAGGGC
ACCAAGGCACCTCAGGCCGCTGGAGTCATCCACACAGATTTCGAGAAAACTTTCATTCAGGCAATCGTTTACAACTTCCG
GGATCTCAAGGAGCTAGGCGATGAGGCTGAGGTGAAGGCCAAGGGTAAGATGCTGACCAAGGGACGATTGTATGTCGTCG
AGGACGGCGACATTCTTCTCATCAAGGCAGGTGCTGCGAAGAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62