GenePrediction:GLEAN_7461 Details

Name: GLEAN_7461
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1966384..1963790 (- strand)
Length: 2595
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1966384..1964096 (- strand)
Length: 2289
Type: CDS
Source: GLEAN
Position: GCSC_140:1964017..1963790 (- strand)
Length: 228
>GLEAN_7461 class=GenePrediction position=GCSC_140:1966384..1963790 (- strand)
ATGACGGCGAAGACGAGGGCCGAGTCGAACTCCTCGGCGACAGCACCGGCTGCTGCTGGGGCGATGCTGCCGACAGGACC
AGGAAGGCACCGTTTTGACCCGGACGCGTCCATCGTGCTGGTCGGCTGTCGCGGGGCGGGCAAGCGGTCGCTGGGCTTTA
TCGGAGCGCTGCATCTGCGGCGTCGCCTCGTGACCGAAGACCACTATTTTGGACAGGCAACGGGTGAGACGCGTGCCGAA
TACCTCAGCCGACACGGACGGGAGGTGTTTGTGCGGCGCAGCGCCGAGGTGTTCAAGCAGATGCTGGAGGCCAACAGCCG
GCGCTGCATCATCGAGTGCGGGATGAGCAGCCTAACGGGTGAGGCCCAGGAGGCTCTACGCCGGTATTGCGCTTCGCACC
CGGTCATTTACGTGCATCGTGAGCGCGAGCAGGTCCTGCGGTTTCTCGACGCCGCTGACGCTGACCAGCTGCTGCGAGCT
GACGAGAGCCACCGGCGGTGCTCTAACCTAGAGTACTACAACCTGATTGAGTCAGGTGAGCATCAGAACCAGAACCAGAA
ACTGTCAACAGGAGTCAGCAGCGGCAGAAACAGCCCGGAGCGCCACTCGGTGTCGCGGCTGCTCTGCGTCAAAGAAGACT
TCACCCGCTTCCTCGACCTCCTGCAGGGTCAAACATGGCAGAGACAATGGGCCGAGAGCCCGTTTTCGCTGAACGCAGTG
CCACCCGAATTCCGCAGCCACTCGTTCGCGCTACGGCTGCGGCTGTCGTACCTGCTGGTCATGGACCTCGAGTGGGAGGA
CTACGAGGCGTGTGGCGACTGCGTGGAGCTCATCATCGACCGGTGGCCCGACGACCTGTTCAACCTGGTGGCCCGCCAGG
TGGCTTTAATCCGCCGCAAGCTGGCCATGCCCATCATCTTCCACGTGGAGGAGAAGCCGCGGGGCGAACGCGACAGGACG
CTGGCTGAGCGAGACCACATGGACGCCGAGCTGCTGGAGCTGGGCCTGCGACTTAACGTCGAGTACATCAGCCTGGACCT
GCAGCGCAGCGACGAGCTGGTGCAGCGCATTCTAGCCCAGCGTGGCCGCACAGCCGTCATGGGCAACTTCTGGTTTCCCG
GCCTGGAGGCGCCGCCGTGGTCATCTGACGTGCATCTGCACAATTACGAGCGTGCCATGGCCCTCGGCTGCAGTATCGTG
CGCATTGTGCGCTTCAATCGTGGCGGCGGAAGTGGTGGCGAGCCGTCCGGGTCCTCGGCCGACTTCACGGCACGGCTGGA
CGTCCTGGTGCCCGATCCCAAGCCGCTGCTGGTGGCTTTTGACTACTCTATCCTCGGCATGTGCACACCGAGCCGAAATC
GGATCTTCGTGCCCGTTAAGCACCCCAGCTCGGTTGGCCACGGTGATCATCTTGCCACCGTCACCACGATGGCTTCGTTG
TTCAGCTACATGTTCCGCGAGCGGCGTCTGGACGCCCTCGACTTCTTCACCGTTGGCTCGCACATCGACTACTCCATCAC
ACCGGCTGTCAACACGGCTGCCTTTGCCTTTGCCGGCCTGTGGCACACATTTCGGGCCGCCCAGTGCTCTACGCTCGACG
AGCTCAACCGGCTCTTCCTCAGCCTCGGCACCCGTGCCAACACGACCTTTGGCGGCGCCACGCTGGCTGCACCCTTCAAG
GTTGCCATCCTACCGTACGTTAAGCTGCAGAGCCAGCATGCCGCCGCCTTGGGCGCCGTCAACGTCATCCTACCGCTGCG
TGGCCGTTCGGCCGCCGTGCTTGACCACGCAAACGCCCGCAATCGCGGCGGTTCCTGCAGCGAATTCTACGGCGACAACA
CCGACTGGCGCTCCATCTACATTTGTCTGCAGCGCGCCATCAGCCCGCGCAACGTCGTCCAGCCTTCCCGTACCACCGGC
CTCGTCATCGGCGCCGGCGGCATGGCGCGAGCCGCCATCTACGCCCTCATCCAGCTGGGCTGTCGCCACATTTTTATCTA
CAACCGCACCCGCCAGCACGCCCTTGACGTGGCCCGCCACTTTGACGACTGGGCCCAGGGACTGGCGCTGGCCGGCGCAG
GCGCTGCTGCGAACGGCAGCAGCGACAAGGCGCATCGCCAAATATGTCACGTGCTCAACTCTGTCGACGATCCGTGGCCG
CCAGAATACCAGCCGCCGACCATGGTTGTGTCGTGTGTGCCGGCCGTCAACTCGGACGGCAGCCCCAAGGCCGACTTCCG
CATGCCGAAGCAGTGGCTGACCAGTCCGACGGGCGGCGTCGTGGTGGAGGTGAGAAAGCTGATGGCGATGCCGACGCTCA
TTTTTCTGTTTATTGCATATTGCATATTGCATGCTGACCTCGTATAGCTCGCGTACGAACACCTGGTCACGCCTCTTGTG
GCACAGATGCAGGCCCTCGGCGACTCCGCGTCGCCCGCCTGGGTCGTCGTTGACGGACTGGAGATTGTTAGTGAGATGGC
CATCGAGTCCTTTGAGCTGATGACTGGCCGCATGGCGCCACAGCGCGTCATGAAGGCCGTCTGCCGCCGTGCATGGCAGG
AGCAGCAGCGGCGACGAGCCTTGCCGGCGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62