GenePrediction:GLEAN_7462 Details

Name: GLEAN_7462
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1956111..1953784 (- strand)
Length: 2328
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1956111..1954660 (- strand)
Length: 1452
Type: CDS
Source: GLEAN
Position: GCSC_140:1954596..1953784 (- strand)
Length: 813
>GLEAN_7462 class=GenePrediction position=GCSC_140:1956111..1953784 (- strand)
ATGAGCGCGAATCCGACCGGACAGGCTAGCCAGGCCAACGGCGCAGCCCGGCCACCAAACTCGGCACAGACACCGCGCAA
AGGACCGCCAAACCCGATGCTGCGACGGAAGCGGGTTGTCGACCCGCTGGTGGCCCGAAAAAAGCCGCTGCAGAGGCCTC
CTTCGGTTCGCAACACGAGCGTTCTCTCGGGGGCGATCCGAAATGGGGTGACGTCGTTGAGCCTCCCGTCGGAAGCGCGG
ACGGTGAATCTGAGCAACACGGAAGACGAGGCGAAGAAGGTGTCGTTTGAAGCACAGCGCAGCCTCAACGGCGGATGGAC
AGACCCGGCCCCAACAACGGCATACCGCGACTTTCCGGTTGTGACGACGAAACGGGCACTGAGAGAAGGCATCCGCTACC
ATGTGATGCGATTTGCTAAGGGGGGAAAGGGCGGGGATGCCGAGGGCGAGATCGATCCTACGAACCAAGACGACTTTACG
CGGCCGGTGTCGTTGCACCGTCGAGACCCACGGCAGCCGGCGCCAGGGCGTGCGGTCAAGGAACAAGAGGCGCCGGCAGC
GGCGGCCACGGTGGACGAGACGGAAGCCGAGAAGGCTGCTCAACAGCGTGCGGATCGCGAAGCACAGCGGCAGGTAGATC
TGGCGCAAATTGCGCCTGTTGCAAAGGAAGCCAACGCGAAGAAGCCGCCACCGAACCAGAAGAAGGAAAAGCAGTTCCAG
TTCTACTTTCCAAAGAACACGGCGGAGCAGAAGAAGGAGTCAGAGATCCGGTACGAAGAGGCGCTTCCGTGGCACCTGGA
GGATGCAGACGGGAAAAACGTGTGGGTGGGGTCGTACATTTCGGCTCTGTCAGAGGCAAATGTTGCGCTGGTGATCAGCG
GGTCGGCATTCCGGATGGTGCCGCTGGAGAAGTTCTATCGGTTCACGCCGAAGCCGCCTTTCCAGGCCTACTCGATCGAG
CAGGCGGAGGAGATCATGAGCAAGAAGATGAGCGCCAGTCGGTGGGCGATGCGCGACACGGAGAAGCGGAAGCAGGAGGA
CGAGCTGGAGGAGACCAGGAGGACGATTGGCGGACGGTCTCGCGTCAAGCAGGAGAGCAGTACTTTCCGATCGGCACCGC
GGTCGGAGAAGATGGAACACGACGACATCGACATGGAGGGAGATGAGTTCCAGGACGACGACGAGAATATCAACTTGGAG
CCGGACAATGACGAGGACTCCAAGGTGACGCGAGAGCGTCTGCGGCGTAACCATCTTGGGGCGAATCTGTTTGGCGACGC
GGACGAGAAGGAGGTAGACAAGGCAGAGGAAGAGGACAAGGTGGAAAAGAAGACGCGACAGCTTGGCAAGCACCTCCGCA
AGGCACTGGCCAAGCGGGAGGACCACCTGGAGTACCTAGAATATGTGGACTCGGACACGAACTCTGAGAAGGAGGATTTT
TTGGATCTCTCGGTTTGTGCCTGAGCCCTGGCGTTTGTGCTTTACGATTGACAGTCACTAACACGAGGGACACAGAGCGA
CGATGAGGACGACGAGGCGGACAGCGAGAAGAAAGACGAAGAGTCCAAGGCTAAGGCGGAAGCGAAGGAGAAGGAGAAGG
AGAAAGAAAAGGAAAAGGAAAAAGAAAAGGCCGGGACGACGGGCGGGACGCCAAAGGGAAGCACGACGCCATCGGGCAAG
CACAGGACGGTGGAAGCGAAGGTGGGCGAGGGGGCGAAGAAGAGCAAGTCGTTGAAGCGGCCGGGATCGCCGAACCTGTC
AGAATCGAGCGGGAACGAGTCGACGCGCAAGAAGGTGAAGAAGCACGCGATGGGATCGGTGCGGCCAAGCCGGTCGACGA
CGCCGATGACAGGCCAGCCGCGGTCGCTGGTGAAGGGCGGAGCCTTGAGCGATGGTGAGGGGACAGCTGGCGAGATGTCG
GATGGGACGACCGGTGGCAAGAACCGGATCAAATTTGTGAAGAAGTCGGGGGGCGCGATCAACACGCCGACGGGATCACG
GGCCTCGAGCCCCAACGCGATTGCGAATACGAACGTGAACACGGCGTCGCAAGGGCAGCTGGCAGGAAGACCGCGATCGC
CGATCGGGGGCTCGTTGCCGTCGCGTGCAGCGTCGCCGAATGGCGGCAAGGTGGATGCGGCCGAGATCATCAGCATGCTT
CTTTCTGTGCCCGAAGGCATCACGGTTAGCGGCCTGCTTCGGATGTTTGGAAACCGTGTGGGCGATGGGCCGAACCAGAT
GAACCGTAAGGACTGGATCAAGCTGGTCAAGGACAATGCCGTCTTTGGCGAGGACAAGCTTCTGCGGGCCAGAGTGTCGA
AGGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62