GenePrediction:GLEAN_7463 Details

Name: GLEAN_7463
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1949638..1944279 (- strand)
Length: 5360
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1949638..1949403 (- strand)
Length: 236
Type: CDS
Source: GLEAN
Position: GCSC_140:1949332..1947816 (- strand)
Length: 1517
Type: CDS
Source: GLEAN
Position: GCSC_140:1947241..1946334 (- strand)
Length: 908
Type: CDS
Source: GLEAN
Position: GCSC_140:1946281..1945452 (- strand)
Length: 830
Type: CDS
Source: GLEAN
Position: GCSC_140:1945401..1945111 (- strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_140:1945056..1944279 (- strand)
Length: 778
>GLEAN_7463 class=GenePrediction position=GCSC_140:1949638..1944279 (- strand)
ATGGGCGTCCCGAAGCTGCTGGCAACCTTGACGCCGTACGGCGACCGGCGACCATTGGAAGCAGAGCAGGTCGTTATTGA
TGGCCCGGCTCTCGCATACCATGCAGCGAGTCTCTGCCAAGCAGTCCCCCAGCCAGCCGCAGCGTTGAGCCATACGTTTG
ACCAGGCGACGAGCAGCCAGCTGGGCCAGGCAGCGTTGGTGTGGTTGGACGAACTGCGCGGCCGTGGAAACACAATGTAT
GGCTTCATTGTGCTGTTGCCGCGGAAATTCCTGCCGATTAGCTAACACGCCGATTGCCTGTTCCAGATCGGCCTTGTTTT
TTGATGGCTACCTTCCTCGGGCAAAACGGCCCACGCGGTTGGAGCGGACCTACCGCACATCCATGCAGCTGAAGGATATC
TTCGTATCGTACCAGCGTGAGATGCCCGGCTATGAGACGGGCGCATGCCGGACGATCGGTCGGCTGCCAGCGCCGGCGTT
TGTGGTCCCTGCTGTTCTGGACGCCCTTCGCCGCTCTCCCGTGTACGGACCGATGACCAGGTTGGTACCAGGAGAGGCAG
ACACGTTCTGCGCTCAGCACGTGCGGACCAATGGACGTGGCACCGTCATCACATCTGACTCAGATCTGCTTGTGCATGAC
CTGGGTCCGGATGGCAACGTCGTCTTCTTCCGGGACATCGACCTACGGAGACCAGAGGCCGGTGGGCCACAGGGTCTGGT
TGTTCCGGTATTTTCGCCGACTATGATCCGGTCCAGACTGGCCCTCAGTCCTCTGAACGGCATGCAGGCCTTTGCCTTTG
AGCTATTCATGGATCCACATCTATCGATTAACGGACTCATCGAGCGAGCGAGACAGCAAGTGGCCGTAACCCGATATCCG
GAAGAGTATGTGAAATTTCTGGAGCAGTACGATACGCCAGGCCTTCTGGTGGACTCTGCCAGGCAATACAACCTAAACGG
CCTCGATCCGAGGATGTCGGAATATGTCCTGCAATGTCTTTTGCCACCCGGCTGTGAAGCTGGGGTTAGTGGTGGCCGTC
CAAGGTCTACCGATAGTACACCGGACGACAGCATTCTGATATTTGTCCCTCAAATGTTGGAGTCTTGGACGCGGGCTAGT
TCATGGGAGATTAGTGCACCTCTTCGTCAATGCGCATACGGACTACTTCAAGCTGTAGCAGGCCGAAGAATATTGGCAGT
TCGCGAGTATACGCGAATGGCTTCGATGGCCTCGTTAGGAGGTCAGCTCCAGCTGCCGTCTGCCCTCGAGATCACTGAGG
CTGTCGGCAGGCTGACGTCAATATTGCGCCAAATTCAGACACGGGTCCAAGAGCCGTCTCTATGGTGGATCGTACTGTCT
TCGTTCCAGGACATTGAGTGGTCCCGAGAACAGGCAAAAGAATCAGTTTGCTTGACAGTGCTCTGCAAGGAGACACCGGC
AGACGGAATCCTGCAGCGGCCGTCGTGGAATGCCGCGCATTGGATCGCCCAGATTATGGGCACGCTGTACTCGCTGCGGA
TTCTACGACAGCTAGTAGAGTTTGTCGGCCAGGACGCGGGAGAGAAGCACTGGAAACAGGCGACGTCTGGACTGTCAGAG
CTGCGGGAACTGCTGTCCCTTGTAACCCCTCTTGAGGAGTACCCTTCACTCCGGACTCTTCAATACCTCCCTGCAAGGCT
GCGCGAGTCTGGGGCACTAGACCTGATCTCTGAAATGGCCGGACTGCCAAGCCCAATTGACTTCCTGCCCGGGACACGAA
GGAAAAGATCAAACAAGAAGCGAAAACGGCTATCTCAACCGTCGACGATGGACGACAGGCCGCGTCAGTCTAAGAACCCT
TTTTCCGTCCTTGATAACGCCACATAGCTCTCCAGAGATCAATCCCAGAAGCCATCTTAAAGGCTGATCCAAATCGTGGC
GCAAAGGAGATCGTTCTTCAGCGGTCTCTGCAGTGGAGGTGTTCAAGGGAACGCCCATTTAACGCCATTTGGCAGCTCTT
TAAGTGCCTGTAGCCAAACCCCACTTTTCGCGGCGAGGATTGGTGCAAGGCCTCGCAAAAGGGACGCTGTGGGTCTTCAC
CCGTCGCGTCTCGATGGCGCAGAATCGCGTCGCCATAATAAATGCTTTTTGGCGATTTACCACGCACCACTCTAAATATT
GTCCTGCCGGTCACCTCACGCACCATACTACGCATTCGCTTTTTTCTTATTTTTCCGAGCGTCTGGGCATTTGTGCAGTT
TCTTCTATTGGATCTTGCTTTCTGTATTGCTATTGGAAGAGTATAGCGTTTCCGAGAGCAGTCCCAATTACGCAGTCCCT
CTGCCCTTCCTATCTTACCACAACTGTTTTTCCCTCTTCCGATAGCCGTTGCCCTTGGGGGCTCAGCCGGCCAGCAGCCT
GCCCGACGCAGTCAAGGAACCTCCCAAGACGCCTCTCGCCTCCGCCCGTCACCCATGCGTCCCGCGTCCCCTTCGACAAC
ATGTATCTGCCACGCTCACTGATCTCAAAGCTGTATCTGCATCTGCAAAATACGTGCCACCCACTCTCTCCACCCGTGCT
ACTACTGGTGGCTCTCGAACCTGACGCCCTCTGTGCCTGCCGGGTCCTCACGAGCCTGCTCAAGCATGACTACATACCGC
ACAAGATCCAACCTGTGGCCGGCTATGCGGATCTGGCCCGTGTCGGCCGCGAGCTTGTGGCTCCCATGATGCAGACACGC
GGTGGCAACGGTGGTGTCGTGATATGTCTCGGCGTCGGCGGCACCGTGGACCTGGCTACATTCTTTGGCCTGGAGACAGA
CGACGAGCAGTCGGCCGGCGGCGACCTCGCCTATGGTGGCGTCGAGGTCTGGATCTTGGATGCCCATCGGCCGTGGAATT
TGAACAACGTCTTTGGCGGGTTTCCGCTTGAGCCTGCAATCGAGGGCCTGGACGACACGGCGAGCTCCCGGGCGCCTCCT
GGCGTCAAGGGTGGCCGCGTTGAGCGCGCCTACAAGCCAGGCAAGGGCGGCCTCGTGGTCTTTGACGACGGCGACGTCGA
GGATGATCTCGACGCGGAGAGGGATGCATATCTGGCTCTGGCAGACATGCCTGAGGTCGACGAGGACGGAGACGACCCAG
ACTTGGGAGCCAGCGACACCGAGAGCGGCGAAGACGGTGACGTCGAAGAGGATGTTGAGAGCGCAGACGGGGAGGCAGAG
CCAGCAGCACGCGCTGGACAGAAGCGCAAGTCTCTGTCGGACCATGACGACGAGCCGGACAGCGAGGACGACAACCGCCC
GGCACAGAGAAGAAGGAGCAACTCGGTATGTCTTGCCGGAGATGAAGGCTTTCCCTTCTCCGCTAACATGCGTGCAGTCG
AGTCCGATCGCACTACCAGCACGTCCAAAATCACGGCCACTGCTCGTGCTACGAGGCCCGCCGCCAAGAAACGATGTCGA
TCCCACCGAAGCCCCGCAACTGAAGCTGCCGGTGCGGCAGACGAAGAAGGCGCCATCCGCACGCACACTTCGACGCCGCC
TTCTGCAGCTGAGGGCGCGCAACGAGGCCGTGCTGCGCAAGTACTATCGCAAGGGAGCCTCGTACTCGGAACCGATCTCG
TCAATGGCATACTCGCTAGCGTCAGAGCTGGGACGTGAGGACAACGACCTGCTGTGGCTTACCATTGTGGGGGTGACATC
GATGGAGCTGTACGGCCGGTCGTCTGCCGGTGTGGCCGTGAAAGTGCATGGGGCCGAGAGCATGCCAACGGCAGGATGGA
TGGGCATGCGAGGCGCACGGATACGACAGCTTCTGCGCGACGAGGTGCGGCGGTTGAATCCACCAGAGGCCGGTAGCGGA
GGAGGGGGTGGTAACAGCGGTAGCAGTGGTGCAGGAGGGCCAGGAGGCGGACGGATGGGATCGCCAGAGTCAGCAGGTGT
CATTCCGACGACGGCACGCAGCCCGGAAGACACGAGCATCCGGCTGTCGCCCGAGCCCAAGTTTCTGCTGATCCGGCACT
GGAGCCTGTACGACAGCATGCTGCACTCGCCATATCTATTCTCGCGACTCAAGATGTGGAGCGAGACCGGACTGAAGCGG
CTGCACAAGCTGTTTGCCAAGATGGGCGTCAGCCTGGTGCAGTGCCGACAGAGCTACGCGCACATGGACATGATGCTGAA
GCGGGAGCTACGGGTGAAGCTGCTCAAGTACGCGTCGCTGTACAACTTGGACGGGATGGTGCCGACCATCGACACAGACG
GCAAGGACCGGGGCGGGCGGGCAAAGACGGCTGGGGCTTTGTGCGCAGTTGGGGATGGCGAGCGACGCTTAGTGCACAGG
ATGTGGCCGTGGTAATTGGCGCGCTGCTGGAGGTGGGCAAGAGCCCAACGGCGGCGACGACGACAGTCGCGATGGGGTCG
TCGGGAAAATCATCGTCTGATGGCGGTCCTGGGACATCGGACGATGACATGGCGATGTTGTCCGGAGAAGAGGACCCGTC
TGAGGAGTGGGTGCCGCGATTCTGGGAGGCGTATGATGCGCTAGAGAGGTTGGTGATGCTTGATGCCATTGATGGTTGGA
CTTATTGCTGACCTACCGACAGTATCGAGTCGCTCAAGGAGGGCCTGCCGACCGCCAAGTTTCTGCACCGGGCGATCTTC
AACACCGGGTCAGCGCTGATCAAGAAGAAGCAGATCACACACTTGCACGCATTCCGGATGTGTATCGTGAAAGAAGGTCC
GGACGTGGGCGTGTTCAACCATCCGGGAGCTCTGACAAAACTGGCGCTGTGGGTGGGAGAGGCGCTGGCAGAGCAGGAAA
AGGACGCGACCGGGCGGCTGGCACACGGAGGTCGAGGAACGCCGCTGGTGGTGGCGTCGCTAAACGAGAAGCGAGGAGTA
TATGTGGTGGTGGGAACGGGAGGAGGTGGAGGACCGGATATGTTGGCACAAGGACGACAAGCGGTGCAGAAAAAGCAGGA
GGAGCGGGCAGCCAAGACGAAGCAACGGGAGGAGAGGCGCGAGGCACGACGGGCGCAGCGGGAAGAGGCAAGGACGAGGC
GGAAAAAAGAAAACGAGAACAAAGAGGCCAACGACGATGTCGAAGACGAAGACGACGAAGACGAAGACGAAGACGAAGGC
GACGAATCGGAGGGATCGGAAACGGACTCGGACTCGGACTCGGACTCCGGGCTGGCGCTGGACCAGGCAGACAGCAAGAG
CTTTGGGCTGAATCGCTTTGGAACGGCCTTCCAGGATGTCGTGGCAGAGACGAGTGCGCGCGTGCGCATCGACAGCTTTG
AGCATTGCGTGGTGGAGGTGAAGAAGGAGGATCTCAGCGGATTTCTCGAGAGTCTGAGCATGAAGGCGGTGGTCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62