GenePrediction:GLEAN_7464 Details

Name: GLEAN_7464
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1943607..1941547 (- strand)
Length: 2061
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1943607..1943503 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_140:1942423..1942335 (- strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_140:1942252..1942167 (- strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_140:1942089..1941794 (- strand)
Length: 296
Type: CDS
Source: GLEAN
Position: GCSC_140:1941726..1941547 (- strand)
Length: 180
>GLEAN_7464 class=GenePrediction position=GCSC_140:1943607..1941547 (- strand)
ATGGACAGTCCTCGTATCAGGCCTTTTGCCAGCACATGCAACAACAGCCTCAACCGGGCGTTTGTCCCGCAGTCCACCAC
GCAGATGGGCCAACCTCGAGAAGACGTCTAGCCGGTGGCCAGGCCATGGCCACACTCCCCGTCCGTCCATCTCAGAGCGA
CTGCGTCAGCCTCGACACAGCCCTGCGAGGCTGAAGCCCACATTGCACCCAGGGGCCCCACTTTCCCAGGAACACCAGAC
TACACTATGTAAGAACCCTTCTTCGGTTCGGCGTGTGGGAAGGAGACTCGTCCTTGGCGTCGCCCTCTGCACCTTGTCTT
ATCCAACACAGCCACACACGCGAAGCGAACGACGCCATTCAAAGCGACCGCCCCGTCCGTGAGTGAAAACGACAGCAAAA
GCAAGCACGATGACCAAGCATCGCATTCGTACGAGCAGCAGCACGGTGGCCGGCCAGCGAGGGACCCGGACAACGATAAG
AAACGAGCACGCCCCCTTTCTCCTATTCTCCTCTTTCTCCCTCTTTGGCACGACAGACGCAGCCATTAGCCTCGCTCGGA
GCCGCCCTGCGATCCACGCTGGCCGGTCACCGCCTGTTGGGCGCGCAGCTGCCATGCAAATTATGCAGAGACGCCCGTAG
TTAGAGGCCGCCAGCAGCCAGACTCCAGGGCTTCTCCAGCGCCTTGCCACCTATGGCTGCCCGCTCTGGAGGCCCTCTTT
TGCCAGCGCTGTCTCGCCAAGCACCCCTCCAAGGAAGAGTAGTGCACCCCCTCCCTGCTGTTTCGCACCCCTCCTCCATC
GATTGGCGAACCTAATAGTCGGTCGTAATTCCTTCATCCCCCCTTCCGAGACCCCATCGCCTTTTCCCCTTTCCCCCCTC
CCTCCCTTCCTGGTATAGTATCGCTCGCTCGAGAATCAACGCAACTCCCGGCGCCCAATTCCGGCCGCCTATTTTCCTCG
TGAGCAATCTCGCATATAGACTGTGCGTGCGCAAGGGATCGTGCTGCACCGTCTCTTCACCTCCTCCCGACCTGCGCCTA
CTCGACCCTTTTACCCCCTGTCATCCGCCCGTCTGCAGCGATCGGGTTTTTCTCCTGCTCACCGGCGCTTACCGAATCGT
CCACCTGGCGCTCGGCGCATAGCCAATCCCCTGACGAACCCGGACCGACACCACCGCCTGCAAGACGTTCAACTGGAAGA
ACACTGCACGGGCGGAGAAGAAGCACGCCTCGCGAGCCAGTCGTGCGAATTGTTCCGTTGATATGGGCAAATCGTGAGTC
TGCTGTTGCCAAGACAAGGAGCCGGAACTCTTTTTTCTGCCTGTCGCTATCGTGCTGACCTACTCCCGCTTCCAGTCAGT
CCAAGCTATCGCAGGAGCAGCTGTCGGAGCTGCAAAAGTCGACACACTTTGACAAGAAGGAGCTGCAGCAATGGTACAAG
GGTACGTCACTCCCTTCTCCTGTCACCACGGCTGCTGTTGTTGAGCCCCCCCTAACGCGGTCGCCTTCTGCTCGACAGGC
TTCCTGAAAGACTGCCCGTCCGGCATGCTCACCAAGGATGAGTTCCAAAAGATCTACCGCCAATTCTTCCCCTTTGGCGA
CCCGTCGAGTTTCGCCGACTACGTCTTCAATGTCTTCGACAGCGATAAGTCTGGCACCATAGAGTTCAAGGAGTTTATCT
GTGCGCTGAGCGTTACGAGCCGCGGCAAGATGGAGGACAAGCTTGACTGGGCCTTCCAGCTGTACGACATAGACGGCGAC
GGCAAGATCAGCTACGACGAGATGCTCAAGATCGTCGAGGCCATCTACAAAATGGTGTGTTGCGCTCTCTTCTTGTCCGC
TGCTTTTTGTTCGCCTCCACCCACTGACCCTGTTGTTCCAGGTCGGCTCCATGGTCAAGCTGCCCGAGGACGAAGACACG
CCCGAGAAGCGGGTCAAGAAGATTTTTCGCATGATGGACAAAGACGAGAACGGCAGCCTCGACATAAGCGAGTTCAAGGA
GGGCAGCAAGCGCGACGAGACCATCGTGTCCGCTCTGTCGCTTTACGATGGACTGGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62