GenePrediction:GLEAN_7468 Details

Name: GLEAN_7468
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1910710..1907451 (- strand)
Length: 3260
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1910710..1910436 (- strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_140:1910310..1909423 (- strand)
Length: 888
Type: CDS
Source: GLEAN
Position: GCSC_140:1909356..1907451 (- strand)
Length: 1906
>GLEAN_7468 class=GenePrediction position=GCSC_140:1910710..1907451 (- strand)
ATGACTACCACTCTGCAAGAGCCGACTCCTCCCCACGTCAAGACCGAAGAGGAGCTAGACCGGGGTCGTCCACGCAGCCG
CTCGCAGGATAAGGACAGCAACAGCGACGGCTTGGGCGACGACGCCGGCGGTGACGGCGATCCCAATGGCGAAAACTCTT
CGAACTCTGACGGCGGGCCTTCGCGCAAGAGGCGAAGAAGCCGCAAGGGCCTCGACAAGAAGTTCGAATGCCCTCACAAC
GGTTGTGGAAAGAGCTATTCAAGAGCTGAGCATCTGTACGCTTATCCTCGTTGCTTCGCTGCCTCGATGTTCTCCTTGTT
TCTCTCTTGACTCTTCCATTTGCTTCCATGCTCGTGCTGCAAATCCCTTCCCCGTTCTTCTTCTGACTAGCCTCGGCCAG
ACATCGTCACCAGCTGAACCACACGCCCAAGCAGATCTACATGTGCGATTATCCCGGCTGTGAACGCCATTTTGTTCGCC
TGGACCTTTGCAACCGTCACCGGGATCGCCATACTGCCAAGGGCTCGTCACTAAATCGGAAGGATACTTTGACAAGCCAG
ACCTCGCCCATCCAGGACTCGCGGCCCACGTTTGCCGCACGTGGATCCATGTCTCCCGATAGGAACCGACCTGGCACTGG
ATACAACAAGATCGGCGGTGGAAACTCGACCCCCATGCCGTATATACCCATCTCAAACACACCGCCGGGCATGTACTCGA
ACGGCGTCCCCACAACTAACGGCCTCGACTACGGATCTCAGGACCCCTCTGTCGTATCATACGGACAGTCTGTCGACCGC
CAGCGATCACACGCGACTTACCAGCCCCCATCTAGCCCCCAACGCTCGTCTATTCAGGCCAGCGTTGATCCGTACGGTGT
CATGTCACCAATTCCGGCCCAACAAGGCCTCAAAGGCCAAGCAATGGCCGGAACTCCACAGACCTCTGTATTTGTGCAGC
CCCAAAATTTCCCACCCTTCAGCTTGCCACCGTCAAACTTTGCGTCTACACAAGCCGCTGGTGTCACTCGTGAGGCCAGC
GTGCCAACAACTGCTCCAGCTATGGGATACATGGCAGAAACAACCGAGTATGATGCAAGCGCTTCTCAGGCTGGCAGCGA
GATGATGGCACTGGATCAGCTCTCGATGCCCAACACTATGCCGATGTTTGGCAGCGAATCGGTTCTGCAGAAGTCGCCGT
ATGTTGGGCTACCAGAGGATTTTATGACCTACCTGTTCAACGCCTCATCACAGGAAGGCTCGCCCATGGGCACAGTGGTC
TATCCGAAGTACGCATGCTCCTTGTTCATAGCCTGCCGTGGTGACGCGGTAATTTGCTGACCAAGCTCCTCCAGCTATGC
CGAGGTTCAAAACCAGTACAGCGTACCCTATTATGGTTCAGAAGCGGCTCAAATGGGCTACTTTCCGACAGCGCCGCAGC
AGGTCATGTCTGTGACCAATCTGCTGGACCAAAATCTGCCCGAATCGGTCATCTCCGACGAGAAGAGTTTGGAGTTGTTC
GAGCTGATCAGGGATCGTTTCCAAGATAGCGGCCAGTCGCCCATTGCGCGGCGCAAGGAGATGATACTAGAAGGCGACCG
CAGTGACGATTCCCACATGCTCAGCCGCAAAATGATGCAGGCATACATTGTGTCCTACTGGCTCCATTTCAGCGACCAAC
TGCCCATCTTGCACAAACCGACGTTCTCACCCGATCTGACGCCAAATTTGCTACTTCTCTCCATGATAACGATCGGTGCA
GCATGTCTGGACAAGGCGCATGGCCAGAAGACTATTAAAGCTGGTGCCGAGCTCTCCAACTTTCTGGCATCCCACTTGCG
ATGGGAGCTTTTCATGGACCCCAATTTTCGCCCTCCGGCCAAGCTCTGGGTATTTCAAACACTCCTCTTGCTCGAGCTGT
ATGAGAAGATGTACTCGACACGGGAGTTGCACGAGCGTGCCCACATCCACCATGCCACCACCATCACCCTCATGCGTCGT
GGCCGGTCGCTGATTGGGAGGTCAGCGGTCGAGTCGCCCCCAAACTTGCGCAACGGCGACAAGGACCGTGGGTCGCGACA
GTCCTCGACGTCCGGCGTGGCGCACACGGCGGACCACTGGTGGAACAACTGGATCACGAACGAGGCAACTCGGCGCACTG
CCTTTGCCGCCTTTGTTATCGACTCGATCCATGCCACCATGTTCGGCCACTCCACTGTGATGGTGGCCCACGAGATGCGC
CTGCCACTTCCTTGTGACGAAAAGCTATGGATGGCCACGAACGGCGCCGAGGTCGGTCGAATCGAAGCGCAGCTGGCGTC
AGAAGAGGTCAAACCCATTTCGTTCCTAGAGGGTCTCAAACGAACACTGAGTGGCGTTGAAGTGAAGACAAACTCTTTCG
GTCGCACCATTTTGATGTCGGGGCTGCTCAGCATCAGCTGGCACATGCACCAGCGAGATCTGCAAGTGAACTCGCTGGGC
GGGTCGCAGGCTTTGGGCGGACGCGACAAGTGGCGCGGCACGTTGACTCGGGCTTTCGACTCGTGGAAGGCCGACTATGA
CAAGTCCTTCCGCCGAACCGATGGCGGCGTCGACCCCTATTCGTATGACCCGACGAACAGTCAGACCGAGATCAACGCCG
TGTTCGAGAGCCGCGTGGTGCTGCACCATCTCGCGCACATGGCCATGCATGTGGACGTAGTCGACCTGCAGATCTACGCA
CGGGCAAAGCGCCTGCTCGGACGGGCGATCGGCTCGCAGGACCTCAACAGTGCGCAGCGGCGGATGAAGGACTTGTGGGC
GCCGTCGGCCAAGGCCCGTGACGCGACGTACTACGCCCTGCAGTTTCTGTGTTCGGTACTGCTACGCAATGAGGGCAACA
GCCCGCTTACAAACGAATACAACCAGTCCGACAGCGAGACCTATTCGGCCCGCGACGACTTCCTGTTGAACCGGCCATGG
GTTCTCTACTTTGCCGCCCTCGTTGTGTGGTGTTATGGCTATGCCTTGGAGGGACCAAGCACTGGCGTGGTCTTACCGAA
AACACGACAGGAGCAGGTGCAATTGATGCGGGAGTATTTGCACCGTTGTGGCAGCATCACGTCGCCGGAAGATCTCAAGA
CCAAGAGGGGGCTCAACCAGAATAGTGCCCTGTTGCTCGTGCTCAGGGACACCTTTAACAACACTCGGTGGGAGCTTCTG
CACGAAGGTGCTACGTTGTTGGGGAACTGCATCCAGCTGAATGTCGGGCAGCAAGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62