GenePrediction:GLEAN_7469 Details

Name: GLEAN_7469
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1905522..1903576 (- strand)
Length: 1947
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1905522..1905340 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_140:1905073..1904438 (- strand)
Length: 636
Type: CDS
Source: GLEAN
Position: GCSC_140:1904370..1904118 (- strand)
Length: 253
Type: CDS
Source: GLEAN
Position: GCSC_140:1904022..1903857 (- strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_140:1903798..1903576 (- strand)
Length: 223
>GLEAN_7469 class=GenePrediction position=GCSC_140:1905522..1903576 (- strand)
ATGGCCGTTTTGACGCAGCTCCCCCCCGAGATCATCCATGCCATTTTCAGCTCTTGCAGCCCTGATGACCTCGTCTCTCT
CGGCCTAGTCAACCGCTGGGGTCGTGATTTTGTTCACGACAACAATGCTCTCTGCCGCTCTGTCTACTGTTCCCACTTTG
TGCGTCCATGTCTCACGCTGCCGGTGTGTCGGCTATGCTGCTATGCTCGTGATACCTAATATCTGCGGACAGGACGAGCC
TCCTACCAAAGATTTGGACTGGATTCGTGAATTGCGAGACTATCTGCGTCTCAAAGCAATATGTGCCAGCCCAAATCCAG
AAAAGGTATAAGCCGAAAAGACCCCTGCTTAATAGAGTAGCTATGCGCGCCTTGCCGAAGCATATCTACTCAAAGCCTGA
TGCACCCGTTTTGACATCTTACTATACTAATATACCGTACTCGGCACAGAAATCCGAGTTACCGTTTGTCCACGCGACGG
TGACGCGAATCCTCAGCCATTCAGCTCAGATCCAGCCTGGCAGTGCTGACACGCTGTTTGCACACCGGACCTTCCGGAAC
GCGAAGATCCTGGCCGAGCTTCTCGGCTCCAAGTCGAACGAGCGTGCCTTCATGTGCAGATCGTTTCTGTTCGAGAATGG
GCGAGACTGGAGAATGCGACTGCATTTTCCTCAAGCACCCGTTGAAGAACAACAGATGAGTGCCGAGCTGCACTGCCTCT
ACGGTACCATGATACAGCAATACCAGGACGATTTTGTCGATTTTGACACATACCCCCATGCTGCATCTAAAGTCTATGAC
ATTCGGTCATACACTCGTAATACAGGTTGGGGACCTTTCATGGCTGACGGCTCGGGGCGTGGTGATTGGGAAAAAATAGA
AGCCATTCTCATTGCGCTGCGACATAACGCCGTGGCAAAAGGGCTGATGAAATTTCCCGTTATTTCGGAGGTTTGGAACC
ACTCGTTCGGAGGCGCCTGGCCACGGAGCTACGTGCCCATCCGTCGGGACGTCAGTATCACTCCCCGAGAGATCGAGCCG
CTGGACCTCCAAGACCCCTACAATGTGACGGGAACCTGGATGAGAGTATGTTTCCCTCTACACGTTGTCTGTACTGTCTG
TGAGATGGCAGAAGGCTGACTGGCCCGTATAGATTATCTGCTTTCTTGATTACCGTGATTTCTTCCACTTTAACTTCCCG
GACGAGAACGCTCTCCCGGCAGACAGGCCGCGAAGGCCTTTAAACGAAGAAGAAGAAGCACGTCTGGTAATCATGAAGCT
ACATGTCACAAAAATCGACCCGCCTGACGAATACGGTCACCCGGACTACCCTATCGTACATTTTGAAGGGATGTCTCATT
CCATGGACAACCCATGGGATGACAATGCTAACTCCAATCTGCGAGGTGAGATAAGAAGCTTCTACTCCGGAGTCTATCCA
ACTCTAGCAATATTTTGAACAAGCTTGCCTCTAGATTCTAATAGAAATTTGCGTCACTAGGAACGTGCCGCATGACAAAG
CATGGCGAGGTGCACTGGACAACCTTTTACATAGTCGAAGGACAGGAACGTTGGCGCAGTGAGAGCCTCCAGTTGGGCGG
GGTGAGGTCAGGACGAGGAGTTGTTGGCAATTGGTTTGATGCCAACTATGAAATACAGGGACCATGGTATGTTCTCGGCA
CGACATCTTCTTCGTTTGCCTTAGTCTGACATGTGTTGTTGTAGCGGACCGACAGCCTTTTGGAAACTCCACGAGAAAGA
ACCTTTGAAGGGCGATGATTCAAGATTGGAGACGTTTCCCTATTTCCTGGCAGGTCCCACCGACATCAACATCAGCATTG
TCATCAGCATCGACCACCATCACTTTGCTGTCGCCAACAATTTTTATGACGAGGACGAAGACGAAGAGTACCAAGACGAA
GGCGAGGGCGAAGACGATACGGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62