GenePrediction:GLEAN_7471 Details

Name: GLEAN_7471
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1899255..1896739 (- strand)
Length: 2517
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1899255..1899194 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_140:1899137..1898156 (- strand)
Length: 982
Type: CDS
Source: GLEAN
Position: GCSC_140:1898109..1898001 (- strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_140:1897934..1896899 (- strand)
Length: 1036
Type: CDS
Source: GLEAN
Position: GCSC_140:1896811..1896739 (- strand)
Length: 73
>GLEAN_7471 class=GenePrediction position=GCSC_140:1899255..1896739 (- strand)
ATGGCGACGGCAAGCAACACCCAGGCCCACGAGAGTGGCTCTGATACCAACAGCAACTATGGGTGAGTTGTTGTGTCCCT
GTCTGCACCTCGCTCTTCCAGTCTCTTCTGACCTCCAGCGTCGACTACGTCATCCACTTCCTCGTCCCCGAAAAGGAGCG
CAACGAGGCCGAGGCGGCATTTGTGCAGCTGATCGAAGCACTGGCGGCGGCCGGCTTTGCCACCGAGGTGCGTGCCGGTG
CCGACAAGGGCTCGCTGCTCGTGTTCACCAGGCTGGCCTCGGCCGGTCTGCTGCGCACGCAAGTCTACCGCTCGCGGCTG
CAGGACTGGCTATACGGCATTCGCACTCAGGCGCCGCCCAGCCGCAAAACCCAGGGCGGCCGCGACGTCGACCTGGCCGC
CTACTTTGCTGACGAGCCCATCAGCGAGGCCGAGCGTCTCCGCCTGATCTACTTACTGCTGACCCGGTCCCGGAGCGAAG
GCGGCGCCGGCATCACGCCGCCCGGAAGTGACGCTCTCGCTGGTGGCAGCAACCCGCATCGCTTTGTTGCCGGTCTCTTC
CCCCTGCACGACCACGCCTTCAACCGCGCCTGGATCAAGCAGTGGGGCACCAAGTACATGCTCGATGCAACCGACCTCGA
CAGCATTCGTGACAAGTTTGGCGAGCGCGTTGCCTTTTACTTTGCCTTTCTTCAGAGCTACTTTGCCTTTCTGCTCTTTC
CCGCCGCCTTTGGCTTCGGCGCCTGGCTGCTCTTCGGCCAGTTTTCTTGGTTCTATGCCGTCGTCAACTGCCTCTGGTCC
GTCGTCTTCTTTGAGTACTGGAAGAAGAAGGAGGTCGACCTGGCCGTTCAGTGGGGCGTCCGTGGCGTCTCGCAGATCCA
GCTGCCTCGGCCTCAGTTCCGCTTCGACCGCGAGGCCAAGGACCCCGTCACCGGCGAGTCCGTCAAGATCTACTCGCCCT
TCCGCCGTCTCTCCCACCAGCTGCTGCAGGTGCCCTTTGCCCTTGCATGCGTCGCCGCACTCGGCAGCCTGATCGCCCTT
TGCTTTGCCATTGAGATCTTCATCACCGAGGTCTACAGCGGGCCTTTCAAGCAGTATCTGGTAGGCTGCCTCCTCCTACG
CTCTGTCAACATCTCCTAACCTCTAGACCTTCTTGCCTACTATCCTCCTGACCGGCCTTATGCCCGTCCTTACCGGTGTG
CTTTCCAAGGTGGCCGAGAGACTGACCGTGCTGGAAAACTACGCCACGCAAGACAGTATGGACAGCCTCCCATTTAGCCT
GCTTAGACCTTCTTTCGCCTGCTGACAGTGACGACGTGCAGCTCACCAGGCCGGCCTTGTGCAAAAGATCTTTGTCATCA
ACTTCATCACGTCCTACCTGCCCATCTTCCTGACCGCCTTTGTCTACGTGCCCTTTGGCAAGGTCCTCGTGCCGTACCTG
GATGTGTTCCAGATCACGGCGCAGCGCCTGACCGGCGACAACAAGACCGAGACGGCCGCCGAGGTGCAGGTGACGTCGCT
GCCGCCGCCGAGCTTCCAGATCAACCCAGACCGCCTGACGAAGCAGGTCATCTACTTCACCGTGACGGCCCAGGTGGTCA
ACTTTCTCCTCGAGGCCGTCGTGCCGTACGCCAAGCGCCGGGTGTTCAAGGTGGTCAAGGAGGAGATGACGTCGCGCAGC
GGCCAGGGTGTCGTCCACGAGAAGGACGCGCCGGAAGAGTCCGCCTTCCTCGAGCGCGTGCGCAACGAAGCCGAGCTGGG
CGTGTACGACGTCACGATCGACTACCGCGAAATGGTGGTGCAGTTTGGCTACCTGGCACTGTTCTCGGCCATCTGGCCGC
TCACGGCCTGCTCGTTCCTCATCAACAACTGGGTCGAGGCTCGATCGGACGCCATGAAGATCGCCATCGGCAGCCAGCGG
CCCATTCCCTGGCGAGCAGACTCCATCGGACCCTGGCTGGCGCCCTTGGGCTTTTTGTCGTGGCTCGGCAGCTTGACCAG
CGCCGCGGTGGTCTACCTCTTCCGATCGGACCCCCACGGCCCCGACGGCGAGCCCTGGAACATCCGCGGCTGGGCGCTGC
TGCTCAGCATCCTCGTGGCCGAGCACCTGTATCTGGTCGTGCAGCTGGTTGTGCGCTACGTCGTCGATAAGATGGACAGC
CCCGGCCTGCAAAAAGAGCGCGCCGAGCGCTTTGCCCTCCGCAAGAACGTGCTCGCCGAGTCCCTGGGTGTGGCTGAGGC
CGAGGCGGAAGCGCAGCTCAGCCCGGTCGCGTCGAACAGTCCGGCAATCACGCGCGACGTTTTGGAGGAGGACCTTCGCC
AGACTTCGATCCAGAGCCAAGGCTCTCCGGAAGCATTGTAAGTCTGGTGACAGAAAAAAAAACCCAAGAGAAAAAGGAAC
TGCTTGAAATGGGTCAACTGACACAGGTGCTGGGGGCAATACAGGTTTTGGCTTCGCCAGCGTGGTGCCTCTGAGACGAT
CCAGATTGGCCGGGGCTTGATTTCGGAGGTATCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62