GenePrediction:GLEAN_7472 Details

Name: GLEAN_7472
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1894878..1891794 (- strand)
Length: 3085
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1894878..1894653 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_140:1894582..1892997 (- strand)
Length: 1586
Type: CDS
Source: GLEAN
Position: GCSC_140:1892926..1892149 (- strand)
Length: 778
Type: CDS
Source: GLEAN
Position: GCSC_140:1892092..1891794 (- strand)
Length: 299
>GLEAN_7472 class=GenePrediction position=GCSC_140:1894878..1891794 (- strand)
ATGGATGAGGAGGTCGAAGACCTGCTTCTCAGTTCCTTTCTCGAGATCCTCGAGAAGGCCAGGATTGCCATCGATAATGC
CGACGACGGCGGCCACGAGGACATGTCCCGGGCTGCGCATGGCCTCGTCAAAGAGGCCGAGCGTGCCCGCAAGACCATTG
AGCCCATTGCTCGACGCCAGCTCAGCCTGTACGGCATCAACTTTGTCTCGGCCCTGAAGGATCATGGTGAGTTTCGGTGG
CGTGTCAGACCTCCTCTTCGTTTGCTAATTGACCATTCTGTCTGCCCGCGCCCCAGATGGAATTGCCGAGCACATCTTTG
CCCTGACCGAGCTTGTCTACGTCTTTGATGACTACACCACCGTTGACACCTTTGACAGCGAAAGATACAAGGATCTGGGC
AAGCTAGCCCAGCAGACCACGCTGCGTGTCACGTCCATCCTGAAGCGCATGAAGCTGGAGGCACCCGTGGCGTCGCCTCT
TGGTCCGCTCTTTCCGTCTGTCGTCTCGCACACGGACAGCATCGGCGCGAGAAGCAGCTTCGCCAGCAACCTGGACAGCG
TGGTTGCACCGAGTCCTCATCCCAGCAGCGGCGAGCCGTTTGTCGACGGTCCCGTGGTTTCGCGACGAAACACCATGGAC
TCATTTCAGTCTGGGCCTTCCCAGACGCAGTATGGCGACGATCTGCCCGTGATGGGCTCACAGAGCGGACCGGACCTCGG
CTACAACGGCGGTCGGGCACCACGAACGGCCACCCGGTCTTTGCCGCCCTCATTTCCTCCACCACCACCGCCGCTATCGA
GTCCACCGTCTCCCATCCCGGAGATCGTCCCCCCCGAGCCGAATACCAATCCGTGGCAGCTGGGCCAGCGGCCGGTGGAC
ACCATCCCCGAGGGAGAAGAGGACGAGACGACTGGCGGGCAACACGGCTGGGACTTTGCCGGAAAAGAGGCCCTAGTGGT
GGTCGAGCGGCGGCGACGCGTTTCCACACGACCCGACTCGCCGACGCTGCCGGATCTGTCGTCGTCTGCCCAGAGCCCAA
AGAGCCTGCTGGCCTCGTCACCACTACCTCCGCCACCCCAGATAGGCATCCCCTCGCTGGCAGCATATTCGATGAAGTCG
GACGTGCAGCTCATGGACGATGCGGTCGACATCTGGCAGGCACAGGTCGACGAGAGCGAACGCAAGTATGCGCCGTCAGT
CAGTACGTCCCCCCGAACCGTCACGTTGCACCTGCCCCAGGACTTTGCGGCTGCCGAGATGCGGCCACTGTCATCTCGGC
AGCCCCAATCACCACATGCGCCTCTGTTGGTCTTTCCGCCAGCAGCACAGCGCCAGTCAAGGTACAGCACCATGACGACG
GCCACGACGGCCACGACGGCCAGCACGACCAACGGATCCATCTTCAGCATATCCTCATACATGGATGAGCCCGGTCGGAC
ACGCGAGTCGGGCACAGAGCCATTCAGCCCCGGGTCTCCCGGTGGTGGGCTCGTGCCCAATTTTGCGTCCTCATTCGGGT
CAGAGAGCCGGCTCAGCTCGTCTCCGACCGTGGCCGCCTCTCCTGCGCCGGAAAGGAGCCTGCCGCTGTTGCCGGGACAG
GCTCCGGGACAGGCTCCGGGACAGGCTCCGGGACAGGTTCCAGAACGGGTGTCGGAACAGCCGGGCCTGGAGCCTATCAA
TCCGGTGGTGGCCATTGACTCTGGTCTCATCCCTGTGGAATTACCGACTAGTTTGCGCGAGGCCAGCGAGGCCTTTGTTG
CGCCTCGGCCTGCCGACTGCAACATCGGGCCCGGCAGCTCGTTCCACCTGCTCAAGGGATTCTGCGAAGGTGCCAAGGAG
GTTCAGCGTGGGGCTGCTGGCGTTCGTCGGGTGCAGAAGCTGGTCGGTTGCTCTTTTCCTTCTCGGTCTTCCCTCAGCAC
TTGCAATACTGACACAATTGCTCTCTCTACAGTCGTATAGCGGTGTCGGCAGTTTTGCGGCCAAGTGTTCGCACTGCCTC
TACGAGCTGCAGTGGACGGAGGTCGACAGAGACCGCAACAACGCGCCCGACGCAAATTACAGGATGCAGGGAATCGGATT
CCGGCTCCGGTTTCTGTCCAAGAGCCACCTGCCGGCGAAGCAGATCGACGCGCCGCTGTATGCGTGCCTGTTCTGCATGC
AGGAGGGACGGACGATAGAGCAGAGCGACGCGACGGTGTTCTTCAGCCAGGGTCAGCTGTTCAAGCACCTGGCACGGCAT
CCGCGGCCGCTGCCTGATGTGCCGGGGATCACAGTTGTGGACGGGCTAGACCGGCCACCGGAGGTGCAGAACAACTACGA
CCTACACTTCTCGATGCCGGCGGTGAACTCGGAGCTGGAGGGCATCCGGCCGGAGCTGTCACAGCTGCCGACGGGCAAAG
CGGTGGAGACGTTCCGAAAGATGCACGGCTCGCTGCGGCGGCCGCCTGACGACACGTGGCCACACCAATTTCCAGTGGGA
GCCAAGCTGGTCGGGATCGAGTTCCCGGTCAAGTACAAGGGCGAATGGGGCGTGGGCTGGTATGATAACATGCGGGCAGC
GTTTCCGGCGGACATGGTCCGGCTAGACACGCCGTCCAAGAGCGAGATCCGGACGCAAGGCACGAGCTCGATGCGGGTGG
TGACACGGTGGAAGTGGGCTACGGGCAGCGCGTATCGCGGCAGCGAGTGGCTTCGTCTCGACAAGAACGAGACGATTACC
AATGTTGCATGTAAGCGAAGTCTTGTGCGGTGTTCCTTACCTAATCTGCTTACTAATCCTTTTCAGATGCCAGTCCTGCT
CACTGGTGTTGGGCGGGCACCAACTCGCGCGGCAAATGGGGGTACTTCCCACAGTCACACATCGAGCCGAACTCACTGAA
GGAGGTGGGCGGCAGCGATAAGGGCAGCGTGTCCAGCCGCGAGAAGATCAGCGCGATAGGTGGCAGCAGCCTGGGCGCCG
GCGGCTTCTTCATGTCCCGATTCCGCGGGAATAACTCGCTGACCAACAGCAATGGTGGAAACAGCAGTGGGTCGCTACGG
CGACCGGGCAGTGTGGCCAGCTCGTCCACGTCATCGAGTAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62