GenePrediction:GLEAN_7475 Details

Name: GLEAN_7475
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1878470..1877783 (- strand)
Length: 688
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1878470..1878274 (- strand)
Length: 197
Type: CDS
Source: GLEAN
Position: GCSC_140:1878207..1877991 (- strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_140:1877905..1877783 (- strand)
Length: 123
>GLEAN_7475 class=GenePrediction position=GCSC_140:1878470..1877783 (- strand)
ATGAAAACGGCAGCAGTATTCGTCGCCCTCCTCTCGACTGCTTCGGCAGGTCTGAGTTTCTTCGGTGGCAACGATGCTAC
CAGCAACGAGGATCTCAAGATTCCTGGCCGCTCGCCGCTCGAACTCTGTCCTCAGGACCACAGCAAGGATGTCCTTACTA
TCCACAAAGTTGACCTGGCGCCCAACCCACCCGAAGCGTAAGTTAGGCCCTCATCATGTGGTTTCCAATCTCACGACCTG
TACCTTTGATTGACAGTATCTAGTGGCCAAACTCTCGTTATCACCGCCTCTGGCACCGTCTCTGAAACGATCACAGAAGG
TGCATATGTCCTCCTGCAGGTCAAGTACGGCCTGATTCGTCTCATCAGCACTACGGCAGATCTGTGCGAGCAGATTGGGG
AAGTCGACCTCGAGTGCCCTATTGAGAAGGGTCTTCTTTCCATCACCAAGTCGGTCGACTTGCCCAACGAGATCCCTCCT
GTAAGAAGAAACTCTAACCGTGTCCCTTTTTGTTACCCAACTTCAGTTTTTACTCCTCAGACGGCTAACCCATGTACTCT
TATAGGGAAAGTACACAGTCCTGGCCGATGTGTTTACGGCCGATGACAAGCCCATCACGTGCCTGACCGCTACGGTTGTC
TTCAATCGAAAGGACAGCGCTTCCAAAGCGGAGCTTGGCGATTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62