GenePrediction:GLEAN_7476 Details

Name: GLEAN_7476
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1876296..1874683 (- strand)
Length: 1614
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1876296..1876048 (- strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_140:1875963..1874683 (- strand)
Length: 1281
>GLEAN_7476 class=GenePrediction position=GCSC_140:1876296..1874683 (- strand)
ATGCCTCGTCTCGTTCGTCGTCAGCCGTTGATGCAGCGCATCGCGGCTGCCATCAACCCCTGGGACTTTCTCTTGTGGCT
CTCTGAAGAGATCGAAACACGAGAGCTTGACTCCCAGACGGTTGGAACACAGGCTGGTCTGGTTGCCAACTTTCTTTTTT
TGCTGGCTAGAGCAAACTTGGGTCCATCCAACAGCGCGGATGACGACGTTTTCGGCGATGCATCAAGCCATGGCTGGTTT
TCGTATCTGGTGAGTGACAACGGGACGTTCCCAGCGACTTCTACTTCAAGCATGTAGGAGGGTGTTTGGCTGATATTGGA
ACTTGTCCCACAGGTACAAATGCTCGTGTGGACCGGATTTACTCTTTCTGTCGCAAATGCCGTTTTCGTCTTCTCCCGCA
AGCGCCATTACCGTCTCTTCGAAGCTAGCATAGACAAGGCTCCAGGCACACCTTCGGCACACCGGGTGCGTGTGCAGTCC
TCGCCGTCCTCCTCGTCACCCTTCCGACTCCTATCCGACCTTCTGAGCTTCGAAAGTGCCGAATCGCGTTCCCACCCGGA
CAGCAGCCGCGATGTATGGGAGCTGGCTATATGGGATCCACGCCCTGCATCACTTGCTTTTCTGTCGTTTTTCAGCCCTC
TCCATGTTCTCGTGTATCTGTTTGAGCTGCCGCTCGATCCGCTCGAGTCACGGCCGAGCGTCACCGTGTTCAAATGTCTC
GTCCTGCAGGTGGGCCTCTCGGCCATCATGACGCTGATGCAGTCAAGGAACGATCAGCGGCAAAAGGACGCCGCGATTAT
ACAGAAGGAGGTTTTCCACGAGTACGACGAAAAATTTGTGCGGCCACAGCTTCATCCTATCGTCAGGGACGTGGGCACCC
AGGTGACTATGAACGACATCCTCAGCGCTGGTGCCGGCAGCAAGACCGAGCAAATTCCGGTCGAAATCGGCACGCCGACA
ACTCTTATCCGCCGGAGCTTCCAAACCCACCCGAACCAGAATTATGTCAGACATGTCGACCCAGATTATGGAATTTCTGC
TGGCCGTCAGTCGAGCATTGCAGCGGCTCCACGTTTGTTTACGCCAGTCAACAAAGCAATCAGACATTCAGACGCATTTA
CTCCTTCGTATGGCAGCATCTCTCAACCCCGTCAAAGCATGCCCTCTGTCGTGACGCCCAGCTACTCTGCTACAACATCA
ATGGCGCCGACTCCTGCCTCCGCGGTGAGCACGATCAAGAACTCGAGTGCGGCCGCAAACAGCTCTCGCCTACCAACAGC
CTCAACTGGCACAAGCACCAATTTTGGCGGAAGTCTTGGCGTGTATAGCCATGTCAACTCGCCACTGAAGAAAGCTACCA
GCTTGAACGACGTAACTACTCCAACCAGCTGCTTTTCACCACGAAACTCTCGAGAGCTTGCTGCCATCGAACAGCGTGAC
GCAGCAGAGAGGGCGCAGCGGCGGTCTAGCCCACTCAAAGAGGATAGGGCACGGCCAGCAAATGACGAGAAGACGCCTTT
CCGGTCCATAGGCCAATCTACTGCATCGGTCAATCCTTTTGCGAGGGCACGGCCGACTTCTTATAAGTATGAGAGATTTC
CGTCACGGTGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62