GenePrediction:GLEAN_7477 Details

Name: GLEAN_7477
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1870322..1867652 (- strand)
Length: 2671
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1870322..1870223 (- strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_140:1870164..1870133 (- strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_140:1869942..1869868 (- strand)
Length: 75
Type: CDS
Source: GLEAN
Position: GCSC_140:1869805..1867652 (- strand)
Length: 2154
>GLEAN_7477 class=GenePrediction position=GCSC_140:1870322..1867652 (- strand)
ATGCCTTCCATTGACGGTACCCCCCAAACGCTGTACGACAAGGTTCTGGCCGACCACATTGTGGACCAGAAGCTGGACGG
TACGGTGCTTTTGTACATTGGTAAGAGCTGAGGTGCCCCCTCATCTTTGACGACACCGGCTGACGTGAATTTGTGCAGAC
CGGCATCTCGTGCATGAGGTCACCTCACCGGTAGGTCTTCCTCTCTCGACTGGCTCAGCTCAGCTGTGCCTTATCTGAGC
TTTATTTTGGTGTGGATCGTTACCGGTCCGAAAACGGCTGCGCGCCAGGGAAACGTCCAGGAACCACACAGACTGCAGCC
GTACCTGAGTTGGGCTGTCACATTATGCATTGCTGACACCCACCTTTCTCCCCATACTAGCAAGCTTTTGAGGGCCTGAA
GAACGCAGACCGCAAGGTCCGGAGGCCGGACTGCACCCTTGCGACGACGGATCATGTGAGTTACGGATGGCAGGTATTCT
CGCCGATGGCGGCAGCATGCTCACGTGTCTTTGGCAGAACATCCCGACGGTCTCGCGAAAGACGCTCAAAGACATTGCCA
GCTTCATCCAGGAGGATGACTCGCGGACGCAGTGCGTCACGCTGGAGGAGAACGTGCGGGACTTTGGGGTGACGTACTTT
GGGCTGGGCGACAAGCGGCAGGGTATCGTGCACGTGATTGGGCCGGAGCAGGGCTTCACGCTGCCGGGCACGACAGTGGT
CTGCGGCGACAGCCACACGTCGACGCACGGGGCGTTTGGCGCGCTGGCGTTTGGCATCGGGACGAGCGAGGTGGAGCACG
TGCTGGCGACGCAGTGCCTGATCACGAAGCGCAGCAAGAACATGCGAGTGCAGGTGGACGGTGAGCTGGCGCCAGGCGTG
ACGTCGAAGGACGTGGTGCTGCACGTGATTGGGCTGATTGGCACGGCTGGCGGCACTGGCTGTGTGATCGAGTTCTGTGG
GTCGGTGATCCGCAGCCTCAGCATGGAGGCACGCATGTCGATCTGCAACATGTCGATCGAGGGTGGTGCGAGGGCCGGCA
TGGTGGCACCAGACGAGATCACGTTTGAGTATCTCAAGGGACGGCCGTTGGCACCACCGTACGGCTCAGACGAGTGGAAG
CGGGCGGTGGCGTACTGGAAGCAGCTGCAGTCGGACGCTGCGGCAACATACGACATTGACGTGTTTGTGGACGCCAAGGA
CATCATCCCGACGGTGTCATGGGGCACGAGCCCAGAGGCCGTGGTACCGATCACGGGGCGGGTGCCGGACCCAGAGTCGT
TTGCGGACGAGGCGAAGAAGACGGCGGCGCGGCGGATGCTCGATTACATGGGCCTGACAGCGGGCACGCCGATGGAGGAG
ATCCCGATCGACAAGGTGTTTATCGGGTCTTGCACAAACTCACGGATCGAGGATCTGCGGGCAGCTGCAGCGGTGGTGCG
CGGTCGCAAGATTGCAGTCAACGTGAAGCGGGCGATGGTGGTGCCGGGATCGGGACTGGTCAAGACGCAGGCCGAGCAGG
AGGGCCTGGACAAGATCTTCACGGAGGCGGGCTTCGAGTGGCGCGAGGCGGGCTGCAGCATGTGTCTGGGCATGAATCCG
GACATCCTGTCGCCACAGGAGCGTTGTGCCAGCACGAGCAACCGCAACTTTGAGGGTCGGCAGGGCGCCGGCGGCCGGAC
GCACCTGATGAGTCCGGTGATGGCAGCCGCAGCCGGCATCGTGGGCAAACTGACGGACGTGCGCAAGCTGACGACATACA
CGGACAGCCCGCATGTGGGTGCGTTCCGGGCGCGGCCGGATCCGGAGCCGACGACGACGACGACAAGCAGCGGCAAGGCC
CACGTGGACGAGCGAGTGGAAGAGGACGACGAGGAGAAGGAGGCGATTGCAGACCAGCCGCAGGACATTTCACCACACGT
CAACTCGGCGGTGGCCGGACATGGAGCTGTAGGCGGACTGCCAAAATTTGTGGTGCACCGGGGCATCGCGGCGGTGATGG
AGCGGACAAACGTGGACACGGACGCGATCATCCCGAAGCAGTTCCTCAAGACGATCAAGCGGACAGGCCTAGGCAAGGCG
CTGTTCAACGACTGGCGATACCTGGCGGACGGCAGCGACAACCCGGACTTTGAGCTGAACCGGGAGCCGTTCCGGCAAGC
CAAGATTCTGGTGGTGACGGGCGGCAACTTTGGGTGTGGCAGCTCGCGTGAACACGCGCCGTGGGCGCTCAACGACTTTG
GGATCCGCAGCGTGATCGCGCCGTCGTTTGCGGACATTTTCTTCAACAACTCGTTCAAGAACGGGATGCTGATGATCCCA
ATCGCAGACGCGGCCAAGCTGGAGGCGATCGCGGCCGAGGGTCGTGCTGGACGGGAGATCGAAATCGACCTGCCGAAGCA
GGAGATCCGCGATGCCGAGGGCAAGACGATCTGCGGCTTTGACGTGGAGGAGTTCCGCAAGCACTGTCTGGTCAACGGAC
TGGACGACATTGGCCTGACCATGCAGATGGACGACAAGATTGCCGCGTTTGAGCGCAAGATGACGCTGGAGACGCCTTGG
CTGGATGGCCGGGCGTACCTGAAGCGTGGCCGCAACGGCCGTCTGTTGGCCAAGGCAGTGCCGGTGGCAACGACGAATCG
GGGAGAGCCGTTGAAGGCGATGGAATGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62