GenePrediction:GLEAN_7478 Details

Name: GLEAN_7478
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1861809..1860279 (- strand)
Length: 1531
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1861809..1861756 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_140:1861678..1861656 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_140:1861549..1861471 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_140:1861402..1861376 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_140:1861325..1861230 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_140:1860893..1860781 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_140:1860726..1860279 (- strand)
Length: 448
>GLEAN_7478 class=GenePrediction position=GCSC_140:1861809..1860279 (- strand)
ATGGACGAAAACGACCTCGCTGATAACCACAACATTGATCCTGACAGTGACGACGTGAGTATATTGTCCGATGTTTGCTC
TATTCACAGCCGCGATATAATACTTACTGTCTGAACAGGATGGACGCTCAGATGCTGACTCAGCCCTCGGAGATGTACGC
ATACCGTACTTTACAGAGCCAGCTTGTGAAGACTGACTCGCTGTTTTCTTCAATATAAGAATATTTCGCTTTACTCGTCT
ACTGCTTCCCTGCGCTCTAGTCTCGCCAGACATTGTGAGGAGAATGGGCGCAAGTACCACGGGTTCAAGGACGGCAAATA
TGTTCTGCCAACGGACGAGGTGAGTATGTGGAGCTTTCCCGAGGCCACACACAAGACACATGAAGCTGACCATGTCCATG
GGTGTAGGAAGAGCTGCAGCGCCAAGGTCAGCCGGTAAATGCTCTTTTCAGAACCCATGTTCAAGCGTTTAACCTCTTTT
ATAGAATACCAGTACCATTTGTGTCTCGCTACCTTCGGCGCGCATGCCTTCGCTCCCTTCAGGAATCTGCACAGAGTGCT
TGATGTGGGCTGTGGCCGCGGTATGTTACAGACCCTTTCAAGCCCTTTTGCATTAGCAGCGAACTGACCTTGATCGACAG
GTGACTGGGCCATAGATTTTGGTGGGTTTAAATTGGCGTGTATTGTATAATTCTTCAACGTGACACTAACCACCGAAATG
CAGCCGAAGCCCATCCCGAAGCAGAGGCTCGTCTCACCGTCCTGTTATTTCACCTTTGTTCTCAGTATACTAACACAAAC
AAGATCGTTGGAATTGATCTAGCACCTGTTCAGGAGTACTAGTCAGTTGCTTTATCTATCTGCCCCATGTCTGTCTGCTG
ATATGCTGTAGCGTTCCCCCTAATGTCCAATTCCAGATTGATGATCTGGAGGAGCCGTGGACCTTTAGCTTCAAGTACGA
TTACATCCATGTTTCAATGATGACGGGTGCTTTCCGAGACTGGTCAAACTTTTACTATCAGGCGTTCCAGTAAGTCTGAC
ACCCATACAAGTGAAGACACGCAACGCTGATGTTTACCGGCAGTTTTTTGAAGTCGGAGGGATGGGTCGAGATTCAGGAC
ATTGACTTTCCCCTTCAGTGTGCCGATGGTTCTCTCCCCAGCGACAGTGCTATGAGGAGATGGAGCGATCTGATGTTGGA
GGCTAGCCGAAAGTCTGGCTATCTCCTGGACACTTGTGGAAAGGCGGCCGAGCTGATGAGAGAGGCTGGGTTTGTCGACA
TCGTCCGAGTCCCATACAAGTGGCCCATCGGGCCGTGGCCCAGAGACCCAAGCCTCAAGCAGTTGGGAGCTTGGGTGTTT
GAGAACTTCCATGGCGGAATCGAGACCATGTCACTGGCCCTATTCACTCGGTTTCTCGGCTGGAGCCTCGATGAGGTCAG
GGCATTTGCTGAAGAGGCCCGAGCCGAGCTTTGCAACAGGAATTTCCATACGTACTTTGACATGTATGTCACATACGGCC
GCAAGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62