GenePrediction:GLEAN_747 Details

Name: GLEAN_747
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1857022..1857703 (+ strand)
Length: 682
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1857022..1857063 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_97:1857128..1857703 (+ strand)
Length: 576
>GLEAN_747 class=GenePrediction position=GCSC_97:1857022..1857703 (+ strand)
ATGGCCGATCCCTGGGCCCCTCTTGTTTGGATTGACTGTGAGGTAGGTCGAGTCTGGCCGAGACTGTTTTTGAACCTTCT
CTCCTTTTACCCAGCTAACCCCACAGATGACCGGTCTCGATCCCGACTCGGACCAGATCCTCGAGATCTACTGTCTCGTC
ACCGATGGTCACCTGCGTCCCGTCGTGCCCGACGACCCTGGCTGGGGCGCTGTCGTTCACGTGCCTGATGCCGCCGCCGC
GCTCGCCCGCATGGACGCCTGGTGCACCGATCACCACGGTGCCAGCGGGTTGACCGAAGCTGTGCTCGCCTCGACCATCT
CGCCCGAGGCCGCTGCTGCTGGCCTGCTCGCCTACGTGCGCGCCCGCGTGCCCACTCCCCGTGTCGCCCTGCTCGCCGGC
AACAGCGTCCACGCTGACCGCGCGTTCCTCCGCCGCCAGCCCTATGCCGCCGTCATCGAACACCTCCACTATCGCATTCT
CGATGTCAGCACCATCAAGGAGGCCGCGGCTCGCTGGCTGCCCGGAACGCAGACCGGCCAGGACGATGGTGACGCTCCAG
GATCCCACACCTTCAGACCACCCCCCAAAACTGGCACTCATCGCGCTCGTGAAGACATCCTCGAGAGCATCGCCGAGGCT
CGCTTCTACAAAGACACCATCTTCGCCCGGTCACAGAATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62