GenePrediction:GLEAN_7480 Details

Name: GLEAN_7480
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1841989..1840536 (- strand)
Length: 1454
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1841989..1841855 (- strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_140:1841789..1840536 (- strand)
Length: 1254
>GLEAN_7480 class=GenePrediction position=GCSC_140:1841989..1840536 (- strand)
ATGATGGAGTGCAAAAGGGACAACAGCGTGCGGACTGAGCCGCGGCTCATCATCCATGGCGGAGCTGGCAACATTTCACG
CGCGACGATGACGCCGGAGAGATACCGGGCATACAGATCAGCGCTGACGGAGATTGTAGGCCTATCCGCCTCTCCAACAT
GCAAACAGTGACAGCTTGCTAACACCGGATGTGGCGACAGATCTCCCGCAGCAGATCGTACATGATGACGGAGATCGCAG
CGAAGAACGGCAACAGCCGGCGGCCATCGGCGCTGGAATCGGCGACGTTTGCGGTGGTGCTTTTCGAGGACAACTCGCTC
TTCAACAGCGGACATGGAGCCGTTTTTACGCGCGACGGCATCAACGAGCTGGAAGCCAGCGTGATGGTATCGCGAGGACG
GGCAAAGCGAGGAGTCGGCGTCATGGGACTACGGCGGGTCAAGAACCCGATTCTGCTGGCACGTCGGATGCTAGAGCACG
GCGATGTCGATCTGGGCGGACGCGATGCATCGGTTCCATCGTTGGGGAACAGCAGCAGAAGCCACGGCAGCATTGATGCG
CCCAGTGCCCAGGGCCACACGCAGATCTACGGCGCGACCGCTGAGGCTCTGGCAGAGCGCTACGGCTTGCCGCTGGTCGA
GCCTTCGTATTTCTTCACGCAGACCCGCTGGGACGAGCATGTTCGTGCTCTGGAGCGGGAGAAGGAGCAGCAAAAGGCCC
TGAAGGCCGGCTGTGTATCGGCTGCCACTGCCAGCTGGTCAGCGGACGAGTATCTGCCCCAGGGCACTTGTGGCGCAGTT
GCTCTGGACGAGGACGGCGTGGTGTGCTGCGCCACAACTACGGGCGGCCTGACGAACAAGCTGACGGGACGGGTTGGCGA
CACGCCCGTTGTCGGTGCCGGATCCTGGGCTGAGACCTGGTCGGAGGCTGGCGATCCCACAGCTGCTGCTACTGCCCGAC
CGATTGTGGAGCTGTCTGGAGCGTTGCGCAGCCTGCTGGCCGACTGCCTTCCGATTCCCATGCCCATCTCGTTCCAGTAC
AGCTCTCTGGCTCGTTCTTCCTCTTCAACAGCAGCAGCAGTATCCACGACGACACGGTCCCTCGCTCTCTCAGGCACGGG
CAATGGCGACTCTTTTCTGCGTGTGAGCGCCGCGCACACAGTGGCCGCCATGGCCCGGTTCCGGCCAGTCTCGTCAGCAG
AGGCGCTTTCTGCTGTGGCCGGTCCCGGCGGCTTGCTGCAGGAGAGCGCAGGCGATCGCTGGGGCCGCACGGGCGAGGGC
GAAGGCGGTCTGATCGGCATCGAGAGCGTCGTCGTGCGTGACAAGCGCGACGGCGCCGTGCTCGAGGTGCGCAGCTCCAT
CATCCAGGACTGCAACTGCGGCGGCATGTTTCGAGCCTGGATCGACGATGACGGCCAGACGCAAGTCCGGGTTTTCCGGG
ACGAGATGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62